BBa_K2169139 1 BBa_K2169139 GS7 Linker 2016-10-13T11:00:00Z 2016-10-14T01:49:23Z AA sequence from BBa_J18921 extended by one glycin. Linker sequence translating to gsgsgsg. false false _2640_ 25347 25347 9 false 7 feels better than 6. The linker's lenght was chosen arbitrarily. false Filip Cierniak annotation2509106 1 GS7 Linker range2509106 1 1 21 BBa_K2169139_sequence 1 ggatctggttcaggctccgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z