BBa_K2172004 1 BBa_K2172004 Tac Promoter from pGEX-KG vector 2016-10-13T11:00:00Z 2016-10-18T04:07:58Z pGEX-KG This is a tac promoter. false false _2643_ 33651 33750 9 false Two extra sticky ends are added to the gene when it is cloned via PCR. They are needed so that the part can be loaded onto other vectors. false Bowen Xiao BBa_K2172004_sequence 1 tgacaattaatcatcggctcgtataatgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z