BBa_K2179003 1 Cld(-SP) Chlorite Dismutase CDS+RBS from I. dechloratans with His-tag 2016-10-20T11:00:00Z 2016-10-29T02:22:04Z Derived from the soil bacterium Ideonella deschloratans This an engineer derivative of the Chlorite dismutase coding sequence from the soil bacterium Ideonella Deschloratans (Thorell et al. 2003). This enzyme coverts chlorite (ClO2) to oxygen and chloride. The 5' sequence that encodes the periplasmic localization signal has been removed. In addition, a His10x tag has been appended to the c-terminus. An internal BsaI site was eliminated by a a silent C-to-G substution at the third codon position at position 198 of the protein coding sequence. The CDS ends with the. consequetiv codons two stop codons TGA. The part is also flanked at either end by two BsaI sites at either end that are internal to the prefix and suffix of pSB1C3. These sites produce non-palindromic sticky end that are differ from one in sequence. They can be useful for the precise unidirectional ligation of a single gene copy to an an appropriately designed part or plasmid backbone. The CDS is preceded with a strong RBS derived form the the expression plasmid PCB-38-441 which is commercially available from DNA 2.0. Thorell, H.D, Karlsson, J., Portelius, E.and Nilsson, T. Biochimica et Biophysica Acta 1577 (2002) 445???451 false false _2650_ 31733 31958 9 true see above false michael ellison annotation2527367 1 rbs range2527367 1 11 22 annotation2527370 1 BsaI range2527370 1 6 11 annotation2527368 1 chlorite dismutase range2527368 1 27 800 annotation2527377 1 BsaI range2527377 1 807 813 annotation2527418 1 His Tag GGHHHHHHHHHH range2527418 1 765 800 BBa_K2179003_sequence 1 ttttcgagaccttaggaggtaaacatatgaataccccagttgatcgggcgaagatactcagcgcgccaggcgtgtttgtggcgttctcaacttacaaaattcgtcccgactacttcaaagttgcattggctgaacgcaaaggtgcagcagatgaagtgatggcggtcttggaaaagcacaaagaaaaagtgattgtcgacgcctacctgacgcgcggctatgaagccaagagcgactacttcctgcgcgttcatgcctacgatgccgtagcggcgcaggcctttctggtcgatttccgcgccacccgctttggcatgtactcggatgtcacggagagcctggtgggtatcaccaaggcgctaaactatatctccaaggacaagtcgcccgacctcaacaaggggctttccggtgctacctacgccggtgatgcaccgcgctttgccttcatgattccggtcaagaaaaacgctgattggtggaacctgacggacgagcagcgcctcaaggagatggagactcatacgcttccgacgctgccctttctggtcaacgtcaagcgcaagctctaccactcgacggggctcgacgataccgattttattacctacttcgagacgaacgacctcggagccttcaacaacctgatgctgtcgctggccaaggtgccggagaacaagtatcacgtgcgctggggcaatccgaccgtgctgggtaccatccagcccatcgagaacctcgtcaagacgctgtcgatgggcaatggcggtcatcaccaccatcatcaccatcaccaccattgatgaggtctcacccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z