BBa_K2180002 1 BBa_K2180002 Fructose Operator - FruR Binding Site 2016-07-31T11:00:00Z 2016-08-01T02:39:48Z The sequence of the regulatory region comes from this site : http://regprecise.lbl.gov/RegPrecise/regulon.jsp?regulon_id=12681 We add two restriction sites. SacII before and PacI after the regulatory region in order to use it in our project. They allow us to replace a regulatory region with another regulatory region. The regulatory region is composed by two FruR binding sites wich are derepressed in the presence of fructose. false false _2651_ 25719 25719 9 false None false Sofiane Safi-Stibler annotation2481387 1 SacII Restriction Site range2481387 1 1 6 annotation2481388 1 FruR Binding Site 1 range2481388 1 7 27 annotation2481390 1 PacI Restriction Site range2481390 1 47 54 annotation2481389 1 FruR Binding Site 2 range2481389 1 28 46 BBa_K2180002_sequence 1 ccgcggtgaaagattttgatagttattgaatgaatttgaatgatttttaattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z