BBa_K2180003 1 BBa_K2180003 Sucrose Operator - DegU Binding Site 2016-07-31T11:00:00Z 2016-08-01T03:23:47Z The sequence of the regulatory region comes from this site : http://www.prodoric.de/site.php?site_acc=SI002871 We add two restriction sites. SacII before and PacI after the regulatory region in order to use it in our project. They allow us to replace a regulatory region with another regulatory region. The regulatory region is composed by two DegU binding (one forward, one reverse) sites wich are derepressed in the presence of sucrose. false false _2651_ 25719 25719 9 false false Sofiane Safi-Stibler annotation2481392 1 DegU Binding Site 1 range2481392 1 7 14 annotation2481393 1 DegU Binding SIte 2 range2481393 1 17 24 annotation2481394 1 PacI Restriction Site range2481394 1 25 32 annotation2481391 1 SacII Restriction Site range2481391 1 1 6 BBa_K2180003_sequence 1 ccgcgggacattttggttttacagttaattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z