BBa_K2180006 1 BBa_K2180006 PLacO - Promoter LacO for B. subtilis 2016-08-04T11:00:00Z 2016-10-13T10:58:17Z The part is made of a previous IGEM part (add part) This part is made of PlepA promoter, two LacI binding sites and a RBS. There is a PacI restriction site before LacI binding sites and a SacII restriction site after them. They allows us to remplace the LacI binding sites by another operating sequence. A SalI restriction sites is presents before the PlepA sequence that may be used to insert the whole sequence. We use this part in our project to promote the pigment expression under the control of LacI. false false _2651_ 25719 25719 9 false false Sofiane Safi-Stibler annotation2481402 1 PacI restriction site range2481402 1 180 187 annotation2481405 1 SacII restriction site range2481405 1 230 235 annotation2481418 1 NdeI range2481418 1 254 258 annotation2481406 1 RBS range2481406 1 236 246 annotation2481400 1 SalI restriction site range2481400 1 10 15 annotation2481404 1 LacI Operator O1 range2481404 1 209 229 annotation2481401 1 PlepA range2481401 1 23 179 annotation2481403 1 LacI Operator O1 range2481403 1 188 208 BBa_K2180006_sequence 1 ccaagcttggtcgacgtcgaaaagtcaatgtatgaatggatacgggatatgaatcaataagtacgtgaaagagaaaagcaacccagatatgatagggaacttttctctttcttgttttacattgaatctttacaatcctattgatataatctaagctagtgtattttgcgtttaatagtttaattaaaattgtgagcggataacaattaattgtgagcggataacaattccgcggaaaggaggtgtctttatcatatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z