BBa_K2180007 1 BBa_K2180007 PFur - Promoter Fur for B. subtilis 2016-08-04T11:00:00Z 2016-10-13T10:58:33Z This part is based on a previous IGEM part (add part). We add the Fur Box site we found (add site) This part is made of PleiaG promoter, a fur (Ferric Uptake Regulator) binding sites and a RBS. There is a ClaI restriction site before the Fur Box (Fur Binding Site) and a PscI restriction site after. They allows us to remplace Fur Box by another operating sequence. A BamHI restriction sites is present before the PliaG sequence that may be used to insert the whole sequence. We use this part in our project to promote the LacI + LVA expression under the control of Fur. false false _2651_ 25719 25719 9 false We had to check the compatibility of the promoter with the Fur Box. false Sofiane Safi-Stibler annotation2481408 1 PliaG range2481408 1 16 136 annotation2481411 1 PscI range2481411 1 164 169 annotation2481409 1 ClaI range2481409 1 137 142 annotation2481410 1 Fur Box range2481410 1 143 163 annotation2481412 1 RBS range2481412 1 170 180 annotation2481417 1 NcoI range2481417 1 188 193 annotation2481407 1 BamHI range2481407 1 1 6 BBa_K2180007_sequence 1 ggatcccaagcttggcaaaaatcagaccagacaaaagcggcaaatgaataagcggaacggggaaggatttgcggtcaagtccttcccttccgcacgtatcaattcgcaagcttttcctttataatagaatgaatgaatcgattgataatgataatcattatcaacatgtaaaggaggtgtctttatcccatgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z