BBa_K2180011 1 BBa_K2180011 Arsenic Operator - ArsR Binding Site 2016-08-20T11:00:00Z 2016-10-13T11:22:04Z Biobrick based on a previous biobrick made by the iGEM09_Newcastle Team (2009-10-14) : http://parts.igem.org/Part:BBa_K174015 We add two restriction sites. SacII before and PacI after the regulatory region in order to use it in our project. They allow us to replace a regulatory region with another regulatory region. This Region allow ArsR to bind to DNA and repress transcription. In the presence of Heavy Metals such as Arsenic or Cadmium transcription is derepressed because of the fixation to ArsR. Other metalic ions may bind to ArsR. false false _2651_ 25719 25719 9 false false Sofiane Safi-Stibler annotation2481513 1 PacI range2481513 1 59 66 annotation2481511 1 ArsR Binding Site range2481511 1 7 32 annotation2481510 1 SacII range2481510 1 1 6 annotation2481512 1 ArsR Binding Site range2481512 1 33 58 BBa_K2180011_sequence 1 ccgcggagtaatcaaaataaattgatttattttttatttagttaaataaaactaatgattaattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z