BBa_K2180010 1 BBa_K2180010 Cadmium Operator - MntR Binding Site 2016-08-20T11:00:00Z 2016-08-21T01:53:46Z This part is based on a previous part from the Cornell 2009 Team (2009/08/10) : http://parts.igem.org/Part:BBa_K285103:Design We add two restriction sites. SacII before and PacI after the regulatory region in order to use it in our project. They allow us to replace a regulatory region with another regulatory region. This Region allow MntR to bind and repress transcription. In the presence of Cadmium false false _2651_ 25719 25719 9 false false Sofiane Safi-Stibler annotation2481494 1 PacI range2481494 1 46 53 annotation2481495 1 MntR Binding Site range2481495 1 7 45 annotation2481493 1 SacII range2481493 1 1 6 BBa_K2180006 1 BBa_K2180006 PLacO - Promoter LacO for B. subtilis 2016-08-04T11:00:00Z 2016-10-13T10:58:17Z The part is made of a previous IGEM part (add part) This part is made of PlepA promoter, two LacI binding sites and a RBS. There is a PacI restriction site before LacI binding sites and a SacII restriction site after them. They allows us to remplace the LacI binding sites by another operating sequence. A SalI restriction sites is presents before the PlepA sequence that may be used to insert the whole sequence. We use this part in our project to promote the pigment expression under the control of LacI. false false _2651_ 25719 25719 9 false false Sofiane Safi-Stibler annotation2481400 1 SalI restriction site range2481400 1 10 15 annotation2481418 1 NdeI range2481418 1 254 258 annotation2481404 1 LacI Operator O1 range2481404 1 209 229 annotation2481403 1 LacI Operator O1 range2481403 1 188 208 annotation2481405 1 SacII restriction site range2481405 1 230 235 annotation2481406 1 RBS range2481406 1 236 246 annotation2481401 1 PlepA range2481401 1 23 179 annotation2481402 1 PacI restriction site range2481402 1 180 187 BBa_K2180008 1 BBa_K2180008 Terminator 2016-08-04T11:00:00Z 2016-10-13T10:53:37Z This is a double terminator we use in our project for the pigment production. He is made of a transcriptional terminator in forward and reverse direction. There is a BmtI restriction site before the first terminator (forward) and an AvrII restriction site after the second terminator (reverse). false false _2651_ 25719 25719 9 false false Sofiane Safi-Stibler annotation2481414 1 Transcription terminator range2481414 1 7 47 annotation2481415 1 Transcription terminator' range2481415 1 56 101 annotation2481413 1 BmtI range2481413 1 1 6 annotation2481416 1 AvrII range2481416 1 102 107 BBa_K2180016 1 BBa_K2180016 Promoter + Cadmium Operator - MntR Binding Site + Blue Pigment + Terminator 2016-10-13T11:00:00Z 2016-10-23T09:58:35Z This part conisist of the change of the lactose's operator by the CzrA operator ( BBa_K2180001 ) in the biobrick BBa_K2180012 This part conisist of the change of the lactose's operator by the CzrA operator ( BBa_K2180001 ) in the biobrick BBa_K2180012 false false _2651_ 32258 32196 9 false This part conisist of the change of the lactose's operator by the CzrA operator ( BBa_K2180001 ) in the biobrick BBa_K2180012 false Wilhelm Vaysse-Zinkh??fer component2528492 1 BBa_K2180005 component2528486 1 BBa_K2180010 component2528497 1 BBa_K2180008 component2528482 1 BBa_K2180006 annotation2528497 1 BBa_K2180008 range2528497 1 1047 1153 annotation2528492 1 BBa_K2180005 range2528492 1 328 1038 annotation2528482 1 BBa_K2180006 range2528482 1 1 258 annotation2528486 1 BBa_K2180010 range2528486 1 267 319 BBa_K2180005 1 BBa_K2180005 Pigment Blue for B. subtilis with a LVA tail and restriction site (Blue Pigment) 2016-08-04T11:00:00Z 2016-10-21T08:21:50Z This part come from a previous IGEM part (add part) This sequence is coding for a blue pigment we use in our detection system as a reporter. false false _2651_ 32196 25719 9 false We had to improve the codon usage for B. subtilis false Sofiane Safi-Stibler annotation2527141 1 Nde I restriction site range2527141 1 1 6 annotation2527143 1 LVA tail range2527143 1 667 699 annotation2527142 1 Avr II restriction site range2527142 1 706 711 annotation2527137 1 start range2527137 1 4 6 annotation2481399 1 Pigment range2481399 1 4 705 BBa_K2180006_sequence 1 ccaagcttggtcgacgtcgaaaagtcaatgtatgaatggatacgggatatgaatcaataagtacgtgaaagagaaaagcaacccagatatgatagggaacttttctctttcttgttttacattgaatctttacaatcctattgatataatctaagctagtgtattttgcgtttaatagtttaattaaaattgtgagcggataacaattaattgtgagcggataacaattccgcggaaaggaggtgtctttatcatatg BBa_K2180010_sequence 1 ccgcggttgacaagaaaccgggatggtcagatgatgtagataaaattaattaa BBa_K2180016_sequence 1 ccaagcttggtcgacgtcgaaaagtcaatgtatgaatggatacgggatatgaatcaataagtacgtgaaagagaaaagcaacccagatatgatagggaacttttctctttcttgttttacattgaatctttacaatcctattgatataatctaagctagtgtattttgcgtttaatagtttaattaaaattgtgagcggataacaattaattgtgagcggataacaattccgcggaaaggaggtgtctttatcatatgtactagagccgcggttgacaagaaaccgggatggtcagatgatgtagataaaattaattaatactagagcatatgtccgtaattgctaaacaaatgacctacaaagtttacatgagcggcacagttaacggtcactatttcgaagtggagggagatggaaaaggaaaaccatacgaaggtgagcagaccgttaaactcaccgtaacgaagggtggaccacttccgtttgcctgggatattctaagtccgcaatgccaatacgggtcaattcctttcactaaataccctgaggacatcccggattacgttaagcaaagtttcccggaaggatacacatgggaacggattatgaactttgaagacggtgcggtctgcacagtctcgaatgatagtagcatccagggtaattgttttatttatcacgtcaagttctcaggccttaacttccctccgaacgggcccgtgatgcagaaaaagacgcaaggctgggagccaaacacggaacgcctcttcgcaagggatggaatgttgttaggcaataactttatggcgctcaaactggaaggcggtggacattatctgtgcgaatttaaaactacatataaagcaaaaaagccggtcaagatgccgggataccattatgtagatcgtaaactggacgtgaccaatcataataaggactatacatcagtggaacagtgcgaaatctcaatcgctcgtaagccagtcgtggccgctgcaaacgacgaaaactacgctttagtagcttaataacctaggtactagaggctagctcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattatttcctagg BBa_K2180005_sequence 1 catatgtccgtaattgctaaacaaatgacctacaaagtttacatgagcggcacagttaacggtcactatttcgaagtggagggagatggaaaaggaaaaccatacgaaggtgagcagaccgttaaactcaccgtaacgaagggtggaccacttccgtttgcctgggatattctaagtccgcaatgccaatacgggtcaattcctttcactaaataccctgaggacatcccggattacgttaagcaaagtttcccggaaggatacacatgggaacggattatgaactttgaagacggtgcggtctgcacagtctcgaatgatagtagcatccagggtaattgttttatttatcacgtcaagttctcaggccttaacttccctccgaacgggcccgtgatgcagaaaaagacgcaaggctgggagccaaacacggaacgcctcttcgcaagggatggaatgttgttaggcaataactttatggcgctcaaactggaaggcggtggacattatctgtgcgaatttaaaactacatataaagcaaaaaagccggtcaagatgccgggataccattatgtagatcgtaaactggacgtgaccaatcataataaggactatacatcagtggaacagtgcgaaatctcaatcgctcgtaagccagtcgtggccgctgcaaacgacgaaaactacgctttagtagcttaataacctagg BBa_K2180008_sequence 1 gctagctcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattatttcctagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z