BBa_K218012 1 BBa_K218012 LuxO inducible qrr4 promoter with strong RBS 2009-10-18T11:00:00Z 2015-05-08T01:11:30Z source description false false _321_ 0 4333 9 It's complicated false design false Jeremy Kubik component2053848 1 BBa_K131017 component2053850 1 BBa_B0034 annotation2053850 1 BBa_B0034 range2053850 1 284 295 annotation2053848 1 BBa_K131017 range2053848 1 1 275 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K131017 1 p_qrr4 p_qrr4 from <I>Vibrio harveyi</I> 2008-10-27T12:00:00Z 2015-05-08T01:09:47Z >gi|156527546:c1833759-1833376 Vibrio harveyi ATCC BAA-1116 chromosome II, complete sequence qrr4 promoter from Vibrio harveyi false true _259_ 0 1653 9 In stock true 5' upstream sequence of qrr4 containing -12 and -24 regions (specific for Sigma factor 54) true Sonja Georgijevic annotation1990436 1 -24 region range1990436 1 250 254 annotation1990440 1 -12 region range1990440 1 262 264 BBa_B0034_sequence 1 aaagaggagaaa BBa_K131017_sequence 1 gtatcagcaaaaacactacggtggataatcagtaaaaccatgaaactagagccccgcacacttgcggggctttttaattttgaatttctttcttattaaaacgccatttttctgataaatgtattagtagcaatgcgcatggtggcatatttgcatcattttgcattttgcaaatgcgatttgcaaaatgcgtgctcaataaagcaccaatatgcatcaggatcgaagaaaaaaggcgtttttaaaagttggcacgcatcgtgctttatacagat BBa_K218012_sequence 1 gtatcagcaaaaacactacggtggataatcagtaaaaccatgaaactagagccccgcacacttgcggggctttttaattttgaatttctttcttattaaaacgccatttttctgataaatgtattagtagcaatgcgcatggtggcatatttgcatcattttgcattttgcaaatgcgatttgcaaaatgcgtgctcaataaagcaccaatatgcatcaggatcgaagaaaaaaggcgtttttaaaagttggcacgcatcgtgctttatacagattactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z