BBa_K218018 1 BBa_K218018 LuxO D47E with strong RBS 2009-10-17T11:00:00Z 2015-05-08T01:11:30Z Bleh Blah false false _321_ 0 4377 9 It's complicated false Emily! false Emily Hicks component2061890 1 BBa_K218015 component2061892 1 BBa_B0034 annotation2061892 1 BBa_B0034 range2061892 1 1371 1382 annotation2061890 1 BBa_K218015 range2061890 1 1 1362 BBa_K218015 1 BBa_K218015 LuxO D47E, Vibrio harveyi 2009-10-17T11:00:00Z 2015-05-08T01:11:30Z Reference: Waters C.M. and Bassler B.L. Quorum sensing: cell-to-cell communication in bacteria. Annu Rev Cell Dev Biol. 2005;21:319-46. Jeremy A. Freeman and Bonnie L. Bassler. A genetic analysis of the function of LuxO, a two-component response regulator involved in quorum sensing in Vibrio harveyi. 1999a. Molecular Microbiology. 31(2), 665-677. [edit] Usage and Biology Quorum-sensing bacteria produce and release chemical signal molecules termed autoinducers (AIs) whose external concentration increases as a function of increasing cell-population density. Bacteria detect the accumulation of a minimal threshold stimulatory concentration of these autoinducers and alter gene expression, and therefore their behavior. Using these signal-response systems, bacteria synchronize particular behaviors on a population-wide scale and thus function as multicellular organisms. The bioluminescent marine bacterium Vibrio harveyi uses three different AIs???AHL, CAI-1, and AI-2???to control the expression of genes responsible for bioluminescence and numerous other traits. We have designed our System 2 based on V. harveyi AI-2 signaling. V. harveyi AI-2 signal is a furanosyl borate diester, production of which requires the LuxS enzyme. Biosynthesis of AI-2 is dependent on the usage of S-adenosylmethionine (SAM) by the cell in various methylation reactions. For this reason, during periods of exponential growth, there is a very large production of AI-2, thus perhaps signaling to neighbors that a suitable environment for growth (i.e. rich in nutrients) has been found. LuxS catalyzes the formation of the (S)-4,5-dihydroxy-2,3-pentanedione (DPD) intermediate which spontaneously cyclizes and reacts with borate to give AI-2. AI-2 is bound in the periplasm by the protein LuxP, which is constitutively bound to LuxQ, a membrane bound histidine kinase sensor. The binding of AI-2 to LuxP is necessary in regulating the activity of the periplasm-bound LuxQ. At low cell density, in the absence of significant amounts of autoinducers, LuxQ acts as a kinase, autophosphorylates, and subsequently transfers the phosphate to the cytoplasmic protein LuxU. LuxU passes the phosphate to the DNA-binding response regulator protein LuxO. Phospho-LuxO, in conjunction with a transcription factor termed &#963;54, involved in nitrogen metabolism, activates transcription of the genes encoding five regulatory small RNAs (sRNAs) termed Qrr1???5 (for Quorum Regulatory RNA). The Qrr sRNAs interact with an RNA chaperone termed Hfq, involved in mRNA splicing. The sRNAs, together with Hfq, bind to and destabilize the mRNA encoding the transcriptional activator termed LuxR. LuxR is required to activate transcription of the luciferase operon: luxCDABE. Thus, at low cell density, because the luxR mRNA is degraded, the bacteria do not express the genes necessary for bioluminescence. At high cell density, when the autoinducers accumulate to the level required for detection, the kinase activity of LuxQ is overtaken by its phosphatase activity and thus drains phosphate from LuxO via LuxU. Unphosphorylated LuxO cannot induce expression of the sRNAs. This allows translation of luxR mRNA, production of LuxR, resulting in bioluminescence. false false _321_ 0 4377 9 It's complicated false The plasmid containing LuxOD47E (pJAF822) was obtained from Bassler lab (Freeman and Bassler, 1999). Jeremy A. Freeman and Bonnie L. Bassler. A genetic analysis of the function of LuxO, a two-component response regulator involved in quorum sensing in Vibrio harveyi. 1999a. Molecular Microbiology. 31(2), 665-677. false Emily Hicks annotation2061646 1 Mutation range2061646 1 139 141 annotation2061618 1 Stop range2061618 1 1360 1362 annotation2061617 1 Start range2061617 1 1 3 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_K218018_sequence 1 atggtagaagacaccgcatccgttgcggcactttaccgctcttacctcacgccacttggcatcgatatcaatattgttggaacaggcagagacgccattgaaagcctgaaccatcgcattcctgatcttattctgctcgagctccgtctacctgatatgacggggatggacgtattgcacgcggtgaagaaaagccacccagacgtgccaatcatcttcatgacagcccatggttctatcgatactgcggtagaggcgatgcgccacggttctcaagacttcctaatcaaaccatgtgaagcagaccgtttacgtgtcacggtgaacaatgcgatccgtaaagcaaccaaattaaagaatgaagctgacaaccccggtaaccaaaattaccaaggcttcatcggcagtagccaaacgatgcagcaggtttaccgcaccattgactcggcagcgagcagtaaagcgagtattttcatcacgggtgaaagtggtacgggtaaagaagtgtgtgccgaagcgattcacgcagcaagcaaacgcggtgataagccgtttatcgccatcaactgtgcggcaatcccgaaagaccttattgaaagtgagctgtttggtcacgtaaaaggtgcgtttactggtgctgcgaatgaccgacaaggtgcggcagagcttgctgatggcggcaccttgttccttgatgaactctgtgaaatggacttggatcttcaaactaagctattgcgctttatccaaacgggtacattccaaaaagtcggttcttctaaaatgaagagcgtggatgtgcgctttgtgtgtgcaactaaccgagacccttggaaagaagtgcaagaaggccgtttccgtgaagacttgtattaccgtttgtacgtgattcctttgcaccttccgccgctgcgtgagcgtggtaaagacgttattgaaattgcatactcgttgcttggttatatgtctcatgaggaaggtaagagtttcgtccgtttcgcacaagacgtgattgaaagattcaacagctacgaatggccgggtaacgttcgccagttgcaaaacgtattgcgtaatatcgtggtactgaacaatggcaaagagatcacgctggatatgttaccgccaccactgaatcagcctgttgtgcgccaatcggtagcaaaattcattgaacctgacattatgacggtgtcagatattatgccgctttggatgacagagaaaatggctattgagcaggcaattcaagcgtgtgaaggcaacattccacgcgctgctggctatttggatgttagtccatcaacgatttatcgcaagttgcaagcttggaatagcaaggacgaaaaacaaaacgtatgatactagagaaagaggagaaa BBa_K218015_sequence 1 atggtagaagacaccgcatccgttgcggcactttaccgctcttacctcacgccacttggcatcgatatcaatattgttggaacaggcagagacgccattgaaagcctgaaccatcgcattcctgatcttattctgctcgagctccgtctacctgatatgacggggatggacgtattgcacgcggtgaagaaaagccacccagacgtgccaatcatcttcatgacagcccatggttctatcgatactgcggtagaggcgatgcgccacggttctcaagacttcctaatcaaaccatgtgaagcagaccgtttacgtgtcacggtgaacaatgcgatccgtaaagcaaccaaattaaagaatgaagctgacaaccccggtaaccaaaattaccaaggcttcatcggcagtagccaaacgatgcagcaggtttaccgcaccattgactcggcagcgagcagtaaagcgagtattttcatcacgggtgaaagtggtacgggtaaagaagtgtgtgccgaagcgattcacgcagcaagcaaacgcggtgataagccgtttatcgccatcaactgtgcggcaatcccgaaagaccttattgaaagtgagctgtttggtcacgtaaaaggtgcgtttactggtgctgcgaatgaccgacaaggtgcggcagagcttgctgatggcggcaccttgttccttgatgaactctgtgaaatggacttggatcttcaaactaagctattgcgctttatccaaacgggtacattccaaaaagtcggttcttctaaaatgaagagcgtggatgtgcgctttgtgtgtgcaactaaccgagacccttggaaagaagtgcaagaaggccgtttccgtgaagacttgtattaccgtttgtacgtgattcctttgcaccttccgccgctgcgtgagcgtggtaaagacgttattgaaattgcatactcgttgcttggttatatgtctcatgaggaaggtaagagtttcgtccgtttcgcacaagacgtgattgaaagattcaacagctacgaatggccgggtaacgttcgccagttgcaaaacgtattgcgtaatatcgtggtactgaacaatggcaaagagatcacgctggatatgttaccgccaccactgaatcagcctgttgtgcgccaatcggtagcaaaattcattgaacctgacattatgacggtgtcagatattatgccgctttggatgacagagaaaatggctattgagcaggcaattcaagcgtgtgaaggcaacattccacgcgctgctggctatttggatgttagtccatcaacgatttatcgcaagttgcaagcttggaatagcaaggacgaaaaacaaaacgtatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z