BBa_K2184002 1 BBa_K2184002 Guid RNA for coffee bitterness flavor 2016-09-18T11:00:00Z 2016-09-19T11:42:20Z CACATCAGTGAGGAGATTCT 1. The basic assumption of the project is based on the fact that there is a direct link between particular taste affection and the number of receptors for that taste. For this reason, the ability to control the polymorphism of taste receptors may be useful in many ways to human society 2. Guide RNA is a hundred base-long molecule with a unique two dimensional structure which binds Cas9 and guides it to a dsDNA sequence complementary to 21-22 base pairs on the 5' end of the molecule. 3. This molecule was specially designed to be able to identify SNPs in grapefroit flavor and mediate CRISPR editing of the non-taste allele only. false false _2660_ 32576 32581 9 false This molecule was specially designed to be able identify coffee biterness SNP and mediates CRISPR editing of the non-taste alleles only false Margalit Mualem BBa_K2184002_sequence 1 cacatcagtgaggagattct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z