BBa_K2184003 1 BBa_K2184003 Guid RNA for NaCl & Sour flavor 2016-09-18T11:00:00Z 2016-09-19T08:32:59Z AGCTTTCATGACACACACGA Identification of the selected allele for a specific taste receptor encoded and sliced in vitro using the Cas9 enzyme. This change will allow us to control and navigate the ability of the sense of taste as needed. Cas9 is the endonuclease guided by the crRNA and tracrRNA (or trans-activating crRNA) to cleave specific DNA sequences. Binding specificity is based on the gRNA sequence and a three nucleotide NGG sequence called the protospacer adjacent motif (PAM) sequence. false false _2660_ 32581 32581 9 false This molecule was specially designed to be able to identify SNP in NaCl & Sour flavor and mediates CRISPR editing of the non-taste alleles only false Margalit Mualem BBa_K2184003_sequence 1 agctttcatgacacacacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z