BBa_K2184004 1 BBa_K2184004 Guid RNA for umami&monosodiom glutamat flavor 2016-09-18T11:00:00Z 2016-09-19T08:59:13Z CTACAACCGTGCCCGTGGCC Guid RNA for cas9 for umami & monosodiom glutamat flavor- The basic assumption of the project is based on the fact that there is a direct link between particular taste affection and the number of receptors for that taste. For this reason, the ability to control the polymorphism of taste receptors may be useful in many ways to human society, for example, specific desirable diet aid by reducing the ability to feel a specific unhealthy taste, reducing alcohol consumption by changing sensitivity to alcohol, reducing the risk of high blood pressure by eliminating the need for salt taste, changing the sensitivity for bitterness to allow swallowing a pill for the purpose of providing medical care and more. false false _2660_ 32581 32581 9 false This molecule was specially designed to able to identify umami & monosodiom glutamat SNP and mediates CRISPR editing of the non-taste alleles only false Margalit Mualem BBa_K2184004_sequence 1 ctacaaccgtgcccgtggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z