BBa_K2184005 1 BBa_K2184005 SNP for PTC taste - TAS2R38 rs713598 2016-09-18T11:00:00Z 2016-09-25T04:25:45Z Human taste allele engineered selected SNP (Single Nucleotide Polymorphism) in favor of this reaction. the SNp that were created selected enable identification of a certain taste out of the five known senses of taste, each of the tastes will change the variability in the number of alleles that make it possible to identify the tatste . Following is a detail of the SNP as ordered. This selected SNP contein to PTC taste false false _2660_ 32581 32581 9 false It is wild type human allele taste false Margalit Mualem BBa_K2184005_sequence 1 gagtacatttctgttcatttcagtcctggagtttgcagtggggtttctgaccaatgccttcgttttcttggtgaatttttgggatgtagtgaagaggcagccactgagcaacagtgattgtgtgctgctgtgtctcagcatcagccggcttttcctgcatggactgctgttcctgagtgctatccagcttacccacttcca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z