BBa_K2184007 1 BBa_K2184007 Grapefruit juice bitterness SNP- TAS2R19 rs10772420 2016-09-21T11:00:00Z 2016-09-25T04:30:43Z human genomic engineered selected SNP (Single Nucleotide Polymorphism) in favor of this reaction. the SNP that were created enable identification of a certain taste out of the five known senses of taste, each of the tastes will change the variability that make it possible to identify the taste . This selected SNP contein to sweet taste- rs10772420 false false _2660_ 32581 32576 9 false human genomic false David Dubb BBa_K2184007_sequence 1 taaaatgttccagacaccatcagtttgttttctgctagaagacccacgatgctccccttgtgaatctatggagttgagggtttctcttctttcactcagcttaagaaaggtctgttttagcttcctacttcccataatcaggatgaatgagtggaatgaaggatacatgattgcaacagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z