BBa_K2184008 1 BBa_K2184008 SNP for NaCl & Sour taste- TAS1R1 rs17492553 2016-09-21T11:00:00Z 2016-09-25T09:20:29Z Human genomic engineered selected SNP (Single Nucleotide Polymorphism) in favor of this reaction. the SNP that were created enable identification of a certain taste out of the five known senses of taste, each of the tastes will change the variability that make it possible to identify the taste . This selected SNP contein to sweet taste- rs846672 false false _2660_ 32581 32576 9 false Human genomic false David Dubb BBa_K2184008_sequence 1 cctgatgggctgaaaccaccaggacggaaacccaggaaggccccaggcccttgcttctgggaccatgtgggtctgtgctgtctgtggtggcttcatgatacgcgtttctttcagcttttggagcagatccacaaggtgcatttccttctacacaaggacactgtggcgtttaatgacaacagagatcccctcagtagctat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z