BBa_K2184009 1 BBa_K2184009 Consuming Alcoholic SNP taste- TAS2R16 rs846672 2016-09-21T11:00:00Z 2016-09-25T04:35:14Z Human genomic Includes a unique characterization of the composition of taste receptor alleles for the five different tastes. This part will be carried out for each subject. Characterization will be carried out using Taqman technology with the FLUIDIGM system We selected 15 SNPs (Single Nucleotide Polymorphism) in favor of this reaction. Each of the SNP???s that were selected enables identification of a certain taste out of the five known senses of taste, Using SNP segments ??? the Taqman reaction makes it possible to identify the presence of a specific allele tested for a specific taste. Whenever a sample DNA is tested a presence of a specific allele is checked by one of the 15 SNP's we receive a fluorescence signal due to the release of the PROBE and vice versa. 67 DNA samples were tested using this method (samples were collected from 67 students and teachers from the school). Each sample was tested to check the presence of alleles to identify different tastes in accordance to the sequence of the SNP. false false _2660_ 32581 32581 9 false Human genomic false Margalit Mualem BBa_K2184009_sequence 1 aatttgaagaaaaaaatttatgataagaaatttatcttttattcaaccagtgtagcctgtcactttttataaattttatcccataaatgatttgaaggaaattggcaattgagtttatcctactgtatctttgctataaaaactagcaaaaagccagtttacacttagcatcagttttgtaagttttattaaaaatagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z