BBa_K2184016 1 BBa_K2184016 OR10A2 rs72921001-cilantro prefeerence SNP taste 2016-09-22T11:00:00Z 2016-10-06T08:41:01Z Human genomic engineered selected SNP (Single Nucleotide Polymorphism) in favor of this reaction. the SNp that were created selected enable identification of a certain taste out of the five known senses of taste, each of the tastes will change the variability in the number of alleles that make it possible to identify the tatste . Following is a detail of the SNP as ordered. This selected SNP contein to cilantro prefeerence taste. false false _2660_ 32581 32869 9 false Human genomic false Yuval Aharon BBa_K2184016_sequence 1 tcttttaaataagttgtctgctgcttgaaaatggattgtgcgtaaagacggagggtaattatagatataccacctagtcttcttgatccgaggcctacagattttgatcccttctctatcccattctatcaacaatgtcagagtgatccttctaagtagcattatgacaatgtcactctgcagcttcaaatattcaggtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z