BBa_K2184017 1 BBa_K2184017 TAS1R1 rs34160967-NaCl & Sour SNP taste 2016-09-22T11:00:00Z 2016-10-06T08:26:19Z Human genomic engineered selected SNP (Single Nucleotide Polymorphism) in favor of this reaction. the SNp that were created selected enable identification of a certain taste out of the five known senses of taste, each of the tastes will change the variability in the number of alleles that make it possible to identify the tatste . Following is a detail of the SNP as ordered. This selected SNP contein to NaCl & Sour taste false false _2660_ 32581 32865 9 false Human genomic false Tomer Maman BBa_K2184017_sequence 1 cctgatgggctgaaaccaccaggacggaaacccaggaaggccccaggcccttgcttctgggaccatgtgggtctgtgctgtctgtggtggcttcatgatacgcgtttctttcagcttttggagcagatccacaaggtgcatttccttctacacaaggacactgtggcgtttaatgacaacagagatcccctcagtagctat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z