BBa_K2184019 1 BBa_K2184019 TAS2R4 RS2234001- Coffee bitterness SNP taste 2016-09-22T11:00:00Z 2016-09-23T01:20:00Z Human genomic engineered selected SNP (Single Nucleotide Polymorphism) in favor of this reaction. the SNp that were created selected enable identification of a certain taste out of the five known senses of taste, each of the tastes will change the variability in the number of alleles that make it possible to identify the tatste . Following is a detail of the SNP as ordered. This selected SNP contein to coffee bitterness taste false false _2660_ 32867 32867 9 false Human genomic false shahar yona BBa_K2184019_sequence 1 tctggtgaacaccatctacttcgtctcttcaaatacggaaaggtcagtctacctgtctgctttttttgtgttgtgtttcatgtttttggactcgagcagtgtctggtttgtgaccttgctcaatatcttgtactgtgtgaagattactaacttccaacactcagtgtttctcctgctgaagcggaatatctccccaaagat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z