BBa_K2184023 1 BBa_K2184023 SNP for non taster SNP taste- TAS2R38 rs1726866 2016-09-26T11:00:00Z 2016-09-27T01:31:20Z Human genomic for non taster PTCtaste Engineered 15 SNPs (Single Nucleotide Polymorphism) in favor of this reaction. Each of the SNP???s that were selected enables identification of a certain taste out of the five known senses of taste, Each of the SNP???s that were selected Refer to people that unables identification of a certain taste out of the five known senses of taste. Using SNP segments ??? the Taqman reaction makes it possible to identify the presence of a specific allele tested for a specific taste. Whenever a sample DNA is tested a presence of a specific allele is checked by one of the 15 SNP's we receive a fluorescence signal due to the release of the PROBE and vice versa. 67 DNA samples were tested using this method (samples were collected from 67 students and teachers from the school). Each sample was tested to check the presence of alleles to identify different tastes in accordance to the sequence of the SNP. false false _2660_ 32581 32581 9 false SNP for non taster PTC taste by swich C with A base false Margalit Mualem BBa_K2184023_sequence 1 gtctataccagaaactctcgtgaccccagcctggaggcccacattaaagccctcaagtctcttgtctcctttttctgcttctttgtgatatcatcctgtgttgccttcatctctgtgcccctactgattctgtggcgcgacaaaataggggtgatggtttgtgttgggataatggcagcttgtccctctgggcatgcagcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z