BBa_K2184031 1 BBa_K2184031 mutant SNP for non taster grapefruit juice bitterness flavor 2016-09-26T11:00:00Z 2016-09-27T05:54:48Z Human genomic for non taster SNP The basic assumption of the project is based on the fact that there is a direct link between particular taste affection and the number of receptors for that taste. For this reason, the ability to control the polymorphism of taste receptors may be useful in many ways to human society, for example, specific desirable diet aid by reducing the ability to feel a specific unhealthy taste, reducing alcohol consumption by changing sensitivity to alcohol, reducing the risk of high blood pressure by eliminating the need for salt taste, changing the sensitivity for bitterness to allow swallowing a pill for the purpose of providing medical care and more. This molecule was specially designed so that it will able to identify SNPs in one specific flavor-grapefruit juice bitterness. flavors respectively and mediate CRISPR editing of the non-taste alleles only. false false _2660_ 32581 32581 9 false Engineered mutant SNP for non taster grapefruit juice bitterness taste by swich T with C base false Margalit Mualem annotation2485083 1 BBa_K2184001 range2485083 1 1 20 BBa_K2184031_sequence 1 taaaatgttccagacaccatcagtttgttttctgctagaagacccacgatgctccccttgtgaatctatggagttgagggtttctcttctttcactcagcctaagaaaggtctgttttagcttcctacttcccataatcaggatgaatgagtggaatgaaggatacatgattgcaacagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z