BBa_K2184002 1 BBa_K2184002 Guid RNA for coffee bitterness flavor 2016-09-18T11:00:00Z 2016-09-19T11:42:20Z CACATCAGTGAGGAGATTCT 1. The basic assumption of the project is based on the fact that there is a direct link between particular taste affection and the number of receptors for that taste. For this reason, the ability to control the polymorphism of taste receptors may be useful in many ways to human society 2. Guide RNA is a hundred base-long molecule with a unique two dimensional structure which binds Cas9 and guides it to a dsDNA sequence complementary to 21-22 base pairs on the 5' end of the molecule. 3. This molecule was specially designed to be able to identify SNPs in grapefroit flavor and mediate CRISPR editing of the non-taste allele only. false false _2660_ 32576 32581 9 false This molecule was specially designed to be able identify coffee biterness SNP and mediates CRISPR editing of the non-taste alleles only false Margalit Mualem BBa_K2184036 1 BBa_K2184036 mutant SNP for non taster coffee bitterness taste and guidRNA 2016-09-29T11:00:00Z 2016-09-30T09:38:02Z Engineered mutant SNP for non taster coffee bitterness taste and guidRNA. The basic assumption of the project is based on the fact that there is a direct link between particular taste affection and the number of receptors for that taste. For this reason, the ability to control the polymorphism of taste receptors may be useful in many ways to human society, for example, specific desirable diet aid by reducing the ability to feel a specific unhealthy taste, reducing alcohol consumption by changing sensitivity to alcohol, reducing the risk of high blood pressure by eliminating the need for salt taste, changing the sensitivity for bitterness to allow swallowing a pill for the purpose of providing medical care and more. This molecule was specially designed so that it will able to identify SNPs in one specific flavor-coffee bitterness. flavors respectively and mediate CRISPR editing of the non-taste alleles only. Engineered SNP (Single Nucleotide Polymorphism) in favor of this reaction. This SNP enables identification of a certain taste out of the five known senses of taste, Each of the SNP???s that were selected Refer to people that unables identification of a certain taste out of the five known senses of taste. Using SNP segments ??? the Taqman reaction makes it possible to identify the presence of a specific allele tested for a specific taste. Whenever a sample DNA is tested a presence of a specific allele is checked by one of the 15 SNP's we receive a fluorescence signal due to the release of the PROBE and vice versa. 67 DNA samples were tested using this method (samples were collected from 67 students and teachers from the school). Each sample was tested to check the presence of alleles to identify different tastes in accordance to the sequence of the SNP. ThIs molecule WAS specially designed so that it was able to identify SNPs in specific allele flavor respectively and mediate CRISPR editing of the non-taste alleles only. false false _2660_ 32581 32581 9 false Engineered mutant SNP for non taster coffee bitterness taste by swich T with G base. Engineered guidRNA to this SNP using a tool called Crispr.MIT.Edu. guide wAS the same for SNP. the SNP made enough of a difference to create or destroy a PAM site. as Cas9 would cut one kind and not the other (PAM is NGG, so if one SNP had NGG and one had NGC as a SNP,We engineered a guide upstream to this PAM and expect Cas9 to cut the NGG form and not the NGC.) false Margalit Mualem component2485602 1 BBa_K2184033 component2485601 1 BBa_K2184002 annotation2485601 1 BBa_K2184002 range2485601 1 1 20 annotation2485602 1 BBa_K2184033 range2485602 1 29 209 BBa_K2184033 1 BBa_K2184033 SNP for non-taster coffee bitterness taste- TAS2R3 RS765007 2016-09-29T11:00:00Z 2016-09-30T08:51:36Z Human genomic for non taster seet taste Engineered mutant SNP for non taster grapefruit juice bitterness taste by swich T with C base Engineered 15 SNPs (Single Nucleotide Polymorphism) in favor of this reaction. Each of the SNP???s that were selected enables identification of a certain taste out of the five known senses of taste, Each of the SNP???s that were selected Refer to people that unables identification of a certain taste out of the five known senses of taste. Using SNP segments ??? the Taqman reaction makes it possible to identify the presence of a specific allele tested for a specific taste. Whenever a sample DNA is tested a presence of a specific allele is checked by one of the 15 SNP's we receive a fluorescence signal due to the release of the PROBE and vice versa. 67 DNA samples were tested using this method (samples were collected from 67 students and teachers from the school). Each sample was tested to check the presence of alleles to identify different tastes in accordance to the sequence of the SNP. false false _2660_ 32581 32581 9 false SNP for non taster sweet taste by swich T with G base false Margalit Mualem BBa_K2184002_sequence 1 cacatcagtgaggagattct BBa_K2184036_sequence 1 cacatcagtgaggagattcttactagagcgacagactaaattgggcagagacaagagacaggtacagtgaagcaacaggtagaggagtagattaacgagaaaaatataggtatcaacagaaagaacaaagatcagggctgcctaattgctgacatgatgggactcaccgagggggtgttcctgattctgtctggcactcagttcacact BBa_K2184033_sequence 1 cgacagactaaattgggcagagacaagagacaggtacagtgaagcaacaggtagaggagtagattaacgagaaaaatataggtatcaacagaaagaacaaagatcagggctgcctaattgctgacatgatgggactcaccgagggggtgttcctgattctgtctggcactcagttcacact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z