BBa_K2184003 1 BBa_K2184003 Guid RNA for NaCl & Sour flavor 2016-09-18T11:00:00Z 2016-09-19T08:32:59Z AGCTTTCATGACACACACGA Identification of the selected allele for a specific taste receptor encoded and sliced in vitro using the Cas9 enzyme. This change will allow us to control and navigate the ability of the sense of taste as needed. Cas9 is the endonuclease guided by the crRNA and tracrRNA (or trans-activating crRNA) to cleave specific DNA sequences. Binding specificity is based on the gRNA sequence and a three nucleotide NGG sequence called the protospacer adjacent motif (PAM) sequence. false false _2660_ 32581 32581 9 false This molecule was specially designed to be able to identify SNP in NaCl & Sour flavor and mediates CRISPR editing of the non-taste alleles only false Margalit Mualem BBa_K2184037 1 BBa_K2184037 mutant SNP for non taster NaCl & Sour taste and guidRNA 2016-09-29T11:00:00Z 2016-09-30T09:52:11Z mutant SNP for non taster NaCl & Sour taste- Human genomic The basic assumption of the project is based on the fact that there is a direct link between particular taste affection and the number of receptors for that taste. For this reason, the ability to control the polymorphism of taste receptors may be useful in many ways to human society, for example, specific desirable diet aid by reducing the ability to feel a specific unhealthy taste, reducing alcohol consumption by changing sensitivity to alcohol, reducing the risk of high blood pressure by eliminating the need for salt taste, changing the sensitivity for bitterness to allow swallowing a pill for the purpose of providing medical care and more. This molecule was specially designed so that it will able to identify SNPs in one specific flavor-NaCl & Sour. flavors respectively and mediate CRISPR editing of the non-taste alleles only. Engineered SNP (Single Nucleotide Polymorphism) in favor of this reaction. This SNP enables identification of a certain taste out of the five known senses of taste, Each of the SNP???s that were selected Refer to people that unables identification of a certain taste out of the five known senses of taste. Using SNP segments ??? the Taqman reaction makes it possible to identify the presence of a specific allele tested for a specific taste. Whenever a sample DNA is tested a presence of a specific allele is checked by one of the 15 SNP's we receive a fluorescence signal due to the release of the PROBE and vice versa. 67 DNA samples were tested using this method (samples were collected from 67 students and teachers from the school). Each sample was tested to check the presence of alleles to identify different tastes in accordance to the sequence of the SNP. ThIs molecule WAS specially designed so that it was able to identify SNPs in specific allele flavor respectively and mediate CRISPR editing of the non-taste alleles only. false false _2660_ 32581 32581 9 false Engineered mutant SNP for non taster NaCl & Sour taste by swich G with A base. Engineered guidRNA to this SNP using a tool called Crispr.MIT.Edu. guide was the same for SNP. the SNP made enough of a difference to create or destroy a PAM site. as Cas9 would cut one kind and not the other (PAM is NGG, so if one SNP had NGG and one had NGC as a SNP, We engineered a guide upstream to this PAM and expect Cas9 to cut the NGG form and not the NGC.) false Margalit Mualem component2485603 1 BBa_K2184003 component2485604 1 BBa_K2184034 annotation2485603 1 BBa_K2184003 range2485603 1 1 20 annotation2485604 1 BBa_K2184034 range2485604 1 29 210 BBa_K2184034 1 BBa_K2184034 SNP for non-taster NaCl &Sour- TAS1R1 rs34160967 2016-09-29T11:00:00Z 2016-10-06T08:31:11Z Human genomic for non taster NaCl &Sour taste Engineered 15 SNPs (Single Nucleotide Polymorphism) in favor of this reaction. Each of the SNP???s that were selected enables identification of a certain taste out of the five known senses of taste, Each of the SNP???s that were selected Refer to people that unables identification of a certain taste out of the five known senses of taste. Using SNP segments ??? the Taqman reaction makes it possible to identify the presence of a specific allele tested for a specific taste. Whenever a sample DNA is tested a presence of a specific allele is checked by one of the 15 SNP's we receive a fluorescence signal due to the release of the PROBE and vice versa. 67 DNA samples were tested using this method (samples were collected from 67 students and teachers from the school). Each sample was tested to check the presence of alleles to identify different tastes in accordance to the sequence of the SNP. false false _2660_ 32581 32581 9 false Engineered mutant SNP for non taster NaCl & Sour taste by swich G with A base false Margalit Mualem BBa_K2184037_sequence 1 agctttcatgacacacacgatactagagagaagcctatgcccgggcagacaagaaggcccctaggccttgccacaagggctcctggtgcagcagcaatcagctctgcagagaatgccaatgcccaagctcaaagccttctccatgagttctgcctacaacgcataccgggctgtgtatgcggtggcccatggcctccaccagctcctggg BBa_K2184034_sequence 1 cctgatgggctgaaaccaccaggacggaaacccaggaaggccccaggcccttgcttctgggaccatgtgggtctgtgctgtctgtggtggcttcatgatatgcgtttctttcagcttttggagcagatccacaaggtgcatttccttctacacaaggacactgtggcgtttaatgacaacagagatcccctcagtagctat BBa_K2184003_sequence 1 agctttcatgacacacacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z