BBa_K165002 1 BBa_K165002 Kozak sequence (yeast RBS) 2008-10-25T11:00:00Z 2015-05-08T01:10:55Z - Released HQ 2013 The kozak sequence acts as a eukaryotic RBS. It is cloned directly between a promoter and coding region. false false _267_ 0 2512 58 In stock false - false John Szymanski BBa_K392003 1 BBa_K392003 yeast ADH1 terminator 2010-10-09T11:00:00Z 2015-05-08T01:12:20Z Registry parts BBa_K105027 (promoter) and BBa_J63003 (Kozak). Engineered 'cyc100 promoter' of <i>Saccharomyces cerevisiae</i> with Kozak sequence attached downstream. false false _528_ 0 6220 9 It's complicated true Assembled by 3A method. false Tadashi Nakamura, Shuhei Yasumoto, Takahiro Saka, Saya Kakuda BBa_K2185000 1 BBa_K2185000 Penicilium alpha amylase w/out promoter 2016-09-03T11:00:00Z 2016-09-04T04:52:20Z The coding sequence for the amylase enzyme originates from the fungus Penicilium. The actual sequence was taken from NIH's genomic database, GenBank. This composite part contains a genetic construct for the expression of the Pencilium alpha amylase gene, but does not contain a promoter. This enzyme has the ability to break alpha bonds between starch molecules and can thus be used for starch degradation. Components: Kozak Sequence Part:BBa_K165002 Secretion Tag Part:BBa_K792002 Alpha Amylase Coding Sequence ADH1 Terminator BBa_K392003 true false _2661_ 27970 27970 9 false We had to include the bioBrick Prefix and suffix. A Kpn restriction enzyme site was added after the biobrick prefix, for insertion into the plasmid we chose to use. All Kpn and Spe restriction enzyme sites were removed from this sequence using Gene Design's online tool. The sequence was also codon optimized for S.cerevisiae using Gene Design. false Marissa Sumathipala component2482459 1 BBa_K165002 component2482460 1 BBa_K392003 component2482462 1 BBa_K792002 annotation2482460 1 BBa_K392003 range2482460 1 27 155 annotation2482462 1 BBa_K792002 range2482462 1 164 217 annotation2482459 1 BBa_K165002 range2482459 1 1 18 BBa_K792002 1 MFa1-Secre Secretion tag from yeast &#945;-factor mating pheromone (MF&#945;1) 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z Prepro-a-factorHas a Cleavable Signal Sequence [Water et al 1987] This part is the secretion signal peptide for the yeast &#945;-mating factor. This signal peptide directs the secretion of the produced protein, and therefore allows for the exportation of it. This peptides are cleaved once the protein is in the lumen of the ER. false false _1047_ 0 11811 9 Not in stock false None false Manuel Gim??nez annotation2197873 1 secretion tag range2197873 1 1 54 BBa_K165002_sequence 1 cccgccgccaccatggag BBa_K2185000_sequence 1 cccgccgccaccatggagtactagaggcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctattactagagcccgccgccaccatggagtactagagagattcccatccattttcaccgctgttttgttcgccgcttcttctgctttggct BBa_K792002_sequence 1 agattcccatccattttcaccgctgttttgttcgccgcttcttctgctttggct BBa_K392003_sequence 1 gcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctattactagagcccgccgccaccatggag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z