BBa_K2186000 1 BBa_K2186000 gRNA targeting TolC in E. Coli BL21(DE3) 2016-10-13T11:00:00Z 2016-10-14T10:23:26Z This comes from a CRIPSR guide maker using the genome of E.Coli BL21(DE3) Will do. false false _2663_ 33006 33006 9 false We used the Deskgen Software to make this gRNA false Nithin Saripalli BBa_K2186000_sequence 1 aaactgagaccacgtaataaccttgataacgggtctcgtttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z