BBa_K220000 1 BBa_K220000 Sarcoisine Dimethyl Glycine Methyl Transferase (SDMT) 2009-10-17T11:00:00Z 2015-05-08T01:11:30Z Gene isolation from Galdieria sulphuraria SDMT is a plasmid gene (900 bp) that codes for the enzyme that catalyze the first reaction in the salt tolerant pathway that we are interested. This enzyme of this pathway is SDMT, which stands for Sarcosine Dimethylglycine Methyl Transferase. It catalyzes two steps of methylation, both that of sarcosine and dimethylglycine, to our final product, betaine, again using SAM as the methyl donor. The gene we used came from Galdieria sulphuraria, an extremephile that establishes high resistance to osmotic stress as well as acidic, thermal stresses and toxic metals. In our project, we really appreciate that Center for Eukaryotic Structural Genomics at University of Wisconsin-Madison graciously gave us the plasmid containing this gene. We PCR amplified gene SDMT with iGEM designated cutting sites and ribosome binding sites and biobricked it with pSB1A2. '''Reference:''' J McCoy, L Bailey, Y NG, C Bingman, R Wrobel, A Weber, B Fox, G Philips ''Discovery of sarcosine dimethylglycine methyltransferase from Galdieria sulphuraria'' http://www3.interscience.wiley.com/cgi-bin/fulltext/120751555/HTMLSTART false false _323_ 0 4504 9 It's complicated false '''Length:''' 56 '''Fwd:''' 5'- AAC GAA TTC TAC TCT AGA AGG AGG ATA ATT TAA TGA GAG TGG AAA ATA GCA ACG GA-3' '''Length:'' 33 '''Rev:''' 5'- ACC ACT AGT CTA CTA TAT TTT GTC GGA CTT GCG-3' false Sarah Sandock BBa_K220000_sequence 1 atgagagtggaaaatagcaacggacagtcgcaaccagccgcaacttcgaaaacagtgaaggataacgctgagatctattacgacgatgacgatagtgatcggttctacttccacgtgtggggtggcgaagacatccatgtcggactttataaggaaccagttgaccaggatgagataagagaagccagtttgcgtacagacgaatggctcgcatcggaacttgcgatgactggagtgttgcagcgtcaagcgaaaggtcttgacttgggagcaggatacggaggtgcggccaggtttcttgtaagaaaattcggagtttccattgactgccttaacatcgcacctgtccaaaataagaggaacgaagaatataacaatcaagcaggactggcggataatatcaccgtcaagtatggaagtttcttggagattccttgtgaagacaattcctatgactttatctggagtcaagatgcgttcttacattcccctgataagttgaaggtatttcaagagtgcgcaagggtcctgaagcctagaggagtcatggccataacggacccgatgaaggaggatggtattgataaaagttcaattcagcccattcttgaccgcattaaacttcatgatatgggcagcttgggactctatcgcagtttggcgaaggaatgtggccttgtcactcttagaactttcagcagacctgactctcttgttcatcattactctaaagtgaaagctgagcttatcaagaggtccagtgaaatcgcttctttctgcagtcctgagttccaggcgaatatgaagcggggtttggaacactggattgaagggggaagagcaggaaagctaacttggggaggaatgctatttcgcaagtccgacaaaatat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z