BBa_K220003 1 BBa_K220003 ADP - sugar Pyrophosphatase (NudF) 2009-10-17T11:00:00Z 2015-05-08T01:11:31Z Gene isolation E.Coli Strain K12 nudF is a plasmid gene (560 bp) that codes for the protein responsible for the enzymatic reaction in mevalonent pathway to form Dimethylallyl pyrophosphate (DMAPP). Specifically, in our project, we used it in the last step of mevalonate pathway to produce biofuels iso-pentenol. We PCR amplified gene nudF with iGEM designated cutting sites and ribosome binding sites and biobricked it with pSB1A2. '''Reference:''' ST Withers and JD Keasling, ''Biosynthesis and engineering of isoprenoid small molecules'', http://www.springerlink.com/content/p118kp4816486248/fulltext.html false false _323_ 0 4504 9 It's complicated false Length: 53 Fwd: 5'- CGA TCT AGA AGG AGG ATA TAT TAA TGA AAT CAT TAG AAG AAA AAA CAA TTG CC -3' Length: 38 Rev: 5'- TCA CTG CAG ATC ACT AGT TCA TTT TTG TGC TTG GAG CG -3' false Sarah Sandock BBa_K220003_sequence 1 aaatcattagaagaaaaaacaattgccaaagaacagattttttcgggtaaagtcattgatctttatgtcgaggatgtagagctgccaaacggcaaagccagtaaacgtgaaattgtgaaacaccctggagctgtagcggtactagccgtcacagatgaagggaaaatcatcatggtcaaacaattccgtaagccgcttgagcggacgatcgttgaaattccggccggtaagcttgaaaaaggtgaggagccggagtatacggcacttcgggaacttgaagaggaaaccggttatacagcaaaaaaactgacaaaaataactgcgttttatacatcacccggatttgcagatgaaatcgttcacgtttttcttgctgaggagctttctgtgcttgaagaaaaacgggagcttgatgaggacgagtttgttgaagtgatggaggtgacgcttgaagatgcgctaaagctggttgaatcgcgtgaagtatatgatgctaaaacagcctacgcgattcagtatcttcagctgaaagaagcgctccaagcacaaaaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z