BBa_K220004 1 BBa_K220004 Salt Stress Activated Promoter Pro U 2009-10-17T11:00:00Z 2015-05-08T01:11:31Z Gene isolation from K12 E. Coli Genomic DNA The ProU promoter (658 bp) was obtained from wild type K12 E. Coli Genomic DNA. Pro U controls transcription of the Pro U operon which contains three sub-units instrumental in bringing choline and proline into the cell. The promoter is most active during times of osmotic stress. We PCR amplified the gene proU with iGEM designated cutting sites and ribosome binding sites and biobricked it with pSB1A2. '''Reference:''' T Annamalai, K Venkitanarayanan ''Role of proP and proU in betaine uptake by Y. enterocolitica under cold and osmotic stress conditions'' http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2655450/?tool=pubmed" false false _323_ 0 4504 9 It's complicated false Length: 30 Fwd: 5'- AAT ACT AGT CTT TTT TCT GCG CAC CTC ACG -3' Length: 42 Rev: 5'- AAT ACT AGT GCA ATA GAA AGA TTC CTT TAT TTG TCT ATG TCG -3' false Sarah Sandock BBa_K220004_sequence 1 aatatcactacccgcagcagggaaataattcccgccaaatagctttttatcacgcaaataatttgtggtgatctacactgatactctgttgcattattcgcctgaaaccacaatattcaggcgttttttcgctatctttgacaaaaaatatcaactttctcgatttgctctcagcccttatatcacgggaaattccggcgatttgctcgcatcaatattcatgccacatttgccatcaggggttgcctcagattctcagtatgttagggtagaaaaaagtgactatttccattgggtaatatatcgacatagacaaataaaggaatctttctattgcatggcaattaaattagaaattaaaaatctttataaaatatttggcgagcatccacagcgagcgttcaaatatatcgaacaaggactttcaaaagaacaaattctggaaaaaactgggctatcgcttggcgtaaaagacgccagtctggccattgaagaaggcgagatatttgtcatcatgggattatccggctcgggtaaatccacaatggtacgccttctcaatcgcctgattgaacccacccgcgggcaagtgctgattgatggtgtggatattgccaaaatatccgacgccgaactccgtgaggtgcgcagaaaaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z