BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K223003 1 BBa_K223003 Terminator plus SoxS promoter- part to be appended to SoxR gene 2009-07-04T11:00:00Z 2015-05-08T01:11:31Z Terminator plus SoxS promoter- part to be appended to SoxR gene Terminator plus SoxS promoter- part to be appended to SoxR gene true false _380_ 0 4533 9 Discontinued false Terminator plus SoxS promoter- part to be appended to SoxR gene false Suzanne Bartram component2009630 1 BBa_B0010 component2009636 1 BBa_K223001 component2009632 1 BBa_B0012 annotation2009636 1 BBa_K223001 range2009636 1 138 199 annotation2009632 1 BBa_B0012 range2009632 1 89 129 annotation2009630 1 BBa_B0010 range2009630 1 1 80 BBa_K223001 1 BBa_K223001 SoxS promoter 2009-07-04T11:00:00Z 2015-05-08T01:11:31Z SoxS promoter Released HQ 2013 SoxS promoter true false _380_ 0 4533 9 Discontinued false SoxS promoter false Suzanne Bartram BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K223001_sequence 1 aatcgctttacctcaagttaacttgaggaattatactccccaacagatgaattaacgaactg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K223003_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaatcgctttacctcaagttaacttgaggaattatactccccaacagatgaattaacgaactg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z