BBa_K223000 1 BBa_K223000 SoxR binds with NO to activate SoxS (NO promoter) 2009-07-04T11:00:00Z 2015-05-08T01:11:31Z paper SoxR binds with NO to activate SoxS (NO promoter) true false _380_ 0 4533 9 Discontinued false sequence false Suzanne Bartram BBa_K223001 1 BBa_K223001 SoxS promoter 2009-07-04T11:00:00Z 2015-05-08T01:11:31Z SoxS promoter Released HQ 2013 SoxS promoter true false _380_ 0 4533 9 Discontinued false SoxS promoter false Suzanne Bartram BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K223012 1 BBa_K223012 SCP + RBS + SoxR + TT + SoxS + RBS + BLH + TT 2009-07-05T11:00:00Z 2015-05-08T01:11:31Z SCP + RBS + SoxR + TT + SoxS + RBS + BLH + TT SCP + RBS + SoxR + TT + SoxS + RBS + BLH + TT true false _380_ 0 4533 9 Discontinued false SCP + RBS + SoxR + TT + SoxS + RBS + BLH + TT false Suzanne Bartram component2009735 1 BBa_K223000 component2009748 1 BBa_B0012 component2009736 1 BBa_B0010 component2009742 1 BBa_K223001 component2009744 1 BBa_B0034 component2009746 1 BBa_B0010 component2009732 1 BBa_J23100 component2009738 1 BBa_B0012 component2009734 1 BBa_B0034 annotation2009746 1 BBa_B0010 range2009746 1 1596 1675 annotation2009734 1 BBa_B0034 range2009734 1 44 55 annotation2009744 1 BBa_B0034 range2009744 1 742 753 annotation2009742 1 BBa_K223001 range2009742 1 672 733 annotation2009732 1 BBa_J23100 range2009732 1 1 35 annotation2009735 1 BBa_K223000 range2009735 1 62 526 annotation2009736 1 BBa_B0010 range2009736 1 535 614 annotation2009748 1 BBa_B0012 range2009748 1 1684 1724 annotation2009738 1 BBa_B0012 range2009738 1 623 663 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K223012_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatggaaaagaaattaccccgcattaaagcgctgctaacccccggcgaagtggcgaaacgcagcggtgtggcggtatcggcgctgcatttctatgaaagtaaagggttgattaccagtatccgtaacagcggcaatcagcggcgatataaacgtgatgtgttgcgatatgttgcaattatcaaaattgctcagcgtattggcattccgctggcgaccattggtgaagcgtttggcgtgttgcccgaagggcatacgttaagtgcgaaagagtggaaacagctttcgtcccaatggcgagaagagttggatcggcgcattcataccttagtggcgctgcgtgacgaactggacggatgtattggttgtggctgcctttcgcgcagtgattgcccgttgcgtaacccgggcgaccgcttaggagaagaaggtaccggcgcacgcttgctggaagatgaacaaaactaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaatcgctttacctcaagttaacttgaggaattatactccccaacagatgaattaacgaactgtactagagaaagaggagaaatactagatgggtctgatgctgattgattggtgtgcactggctctggttgttttcattggcctgccgcacggcgcgctggatgctgccatttctttttctatgatctcttctgcaaaacgcattgctcgtctggctggtattctgctgatctatctgctgctggcgaccgcgttcttcctgatctggtatcagctgccagcgtttagcctgctgatcttcctgctgatctccattatccactttggtatggcagacttcaacgcgtccccaagcaaactgaaatggccgcatatcatcgcccacggcggtgttgttactgtttggctgccgctgatccagaaaaacgaagtaactaaactgtttagcatcctgactaacggtccgactccgatcctgtgggacatcctgctgattttcttcctgtgttggtctattggcgtgtgtctgcacacgtacgaaaccctgcgctctaaacattacaacatcgcctttgaactgatcggtctgattttcctggcgtggtatgcgccgcctctggttacgtttgccacttacttctgcttcattcattcccgtcgccacttctcctttgtgtggaagcagctgcaacacatgtcttccaaaaagatgatgattggcagcgcgattatcctgtcctgtacctcttggctgatcggcggtggtatctatttcttcctgaactccaaaatgatcgcctctgaggctgcgctacaaactgtgttcatcggtctggcggcactgaccgtgccgcacatgattctgatcgacttcatcttccgtccgcactcttcccgtatcaaaatcaaaaactgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K223001_sequence 1 aatcgctttacctcaagttaacttgaggaattatactccccaacagatgaattaacgaactg BBa_B0034_sequence 1 aaagaggagaaa BBa_K223000_sequence 1 atggaaaagaaattaccccgcattaaagcgctgctaacccccggcgaagtggcgaaacgcagcggtgtggcggtatcggcgctgcatttctatgaaagtaaagggttgattaccagtatccgtaacagcggcaatcagcggcgatataaacgtgatgtgttgcgatatgttgcaattatcaaaattgctcagcgtattggcattccgctggcgaccattggtgaagcgtttggcgtgttgcccgaagggcatacgttaagtgcgaaagagtggaaacagctttcgtcccaatggcgagaagagttggatcggcgcattcataccttagtggcgctgcgtgacgaactggacggatgtattggttgtggctgcctttcgcgcagtgattgcccgttgcgtaacccgggcgaccgcttaggagaagaaggtaccggcgcacgcttgctggaagatgaacaaaactaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z