BBa_K223041 1 BBa_K223041 SoxS Promoter 2009-10-16T11:00:00Z 2015-05-08T01:11:31Z Pseudomonas aeruginosa SoxR Does Not Conform to the Archetypal Paradigm for SoxR- Dependent Regulation of the Bacterial Oxidative Stress Adaptive Response ~Palma et al. http://iai.asm.org/cgi/reprint/73/5/2958?maxtoshow=&HITS=10&hits=10& RESULTFORMAT =&fulltext=coli&searchid=1&FIRSTINDEX=520&resourcetype=HWFIG The SoxS promoter is activated by the SoxR protein in the presence of oxidative stress, such as Paraquat or Nitric Oxide. It has a high affinity binding with the SoxR protein. It can be used in conjunction with the SoxR gene as an inducible sensor for oxidative stress. false false _380_ 0 4533 9 Not in stock false n/a false Suzanne Bartram BBa_K223041_sequence 1 gaattcgcggccgcttctagagaatcgctttacctcaagttaacttgaggaattatactccccaacagatgaattaacgaactgtactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z