BBa_K223040 1 BBa_K223040 SoxR Gene: Produces the SoxR protein 2009-10-16T11:00:00Z 2015-05-08T01:11:31Z GenBank Escherichia coli E24377A http://www.ncbi.nlm.nih.gov/nuccore/NC_009801.1/from=4616553&to=4617017&report=fasta This part produces the SoxR protein, which in the presence of oxidative stresses, such as paraquat and nitric oxide, binds with high affinity to the SoxS promoter. The SoxR generator, when coupled with the SoxS promoter, can be utilized as an inducible sensor for oxidative stress. false false _380_ 0 4533 9 It's complicated false Can be put on both a high, pSB1A3 with AmpR, and low copy plasmid. false Suzanne Bartram BBa_K223041 1 BBa_K223041 SoxS Promoter 2009-10-16T11:00:00Z 2015-05-08T01:11:31Z Pseudomonas aeruginosa SoxR Does Not Conform to the Archetypal Paradigm for SoxR- Dependent Regulation of the Bacterial Oxidative Stress Adaptive Response ~Palma et al. http://iai.asm.org/cgi/reprint/73/5/2958?maxtoshow=&HITS=10&hits=10& RESULTFORMAT =&fulltext=coli&searchid=1&FIRSTINDEX=520&resourcetype=HWFIG The SoxS promoter is activated by the SoxR protein in the presence of oxidative stress, such as Paraquat or Nitric Oxide. It has a high affinity binding with the SoxR protein. It can be used in conjunction with the SoxR gene as an inducible sensor for oxidative stress. false false _380_ 0 4533 9 Not in stock false n/a false Suzanne Bartram BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K223044 1 BBa_K223044 SoxR - SoxS Promoter System 2009-10-16T11:00:00Z 2015-05-08T01:11:31Z Stanford iGEM team 2009. This entire system works as a superoxide sensor. Superoxides activate the SoxR protein to bind with the SoxS Promoter and begin transcription of downstream genes. It is an inducible sensor. false false _380_ 0 4533 9 It's complicated false Works both on a high and low copy plasmid. false Suzanne Bartram component2049121 1 BBa_B0012 component2049125 1 BBa_K223041 component2049118 1 BBa_K223040 component2049117 1 BBa_B0034 component2049119 1 BBa_B0010 annotation2049118 1 BBa_K223040 range2049118 1 21 526 annotation2049117 1 BBa_B0034 range2049117 1 1 12 annotation2049119 1 BBa_B0010 range2049119 1 535 614 annotation2049125 1 BBa_K223041 range2049125 1 672 776 annotation2049121 1 BBa_B0012 range2049121 1 623 663 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K223041_sequence 1 gaattcgcggccgcttctagagaatcgctttacctcaagttaacttgaggaattatactccccaacagatgaattaacgaactgtactagtagcggccgctgcag BBa_K223040_sequence 1 gaattcgcggccgcttctagatggaaaagaaattaccccgcattaaagcgctgctaacccccggcgaagtggcgaaacgcagcggtgtggcggtatcggcgctgcatttctatgaaagtaaagggttgattaccagtatccgtaacagcggcaatcagcggcgatataaacgtgatgtgttgcgatatgttgcaattatcaaaattgctcagcgtattggcattccgctggcgaccattggtgaagcgtttggcgtgttgcccgaagggcatacgttaagtgcgaaagagtggaaacagctttcgtcccaatggcgagaagagttggatcggcgcattcataccttagtggcgctgcgtgacgaactggacggatgtattggttgtggctgcctttcgcgcagtgattgcccgttgcgtaacccgggcgaccgcttaggagaagaaggtaccggcgcacgcttgctggaagatgaacaaaactaatactagtagcggccgctgcag BBa_K223044_sequence 1 aaagaggagaaatactagaggaattcgcggccgcttctagatggaaaagaaattaccccgcattaaagcgctgctaacccccggcgaagtggcgaaacgcagcggtgtggcggtatcggcgctgcatttctatgaaagtaaagggttgattaccagtatccgtaacagcggcaatcagcggcgatataaacgtgatgtgttgcgatatgttgcaattatcaaaattgctcagcgtattggcattccgctggcgaccattggtgaagcgtttggcgtgttgcccgaagggcatacgttaagtgcgaaagagtggaaacagctttcgtcccaatggcgagaagagttggatcggcgcattcataccttagtggcgctgcgtgacgaactggacggatgtattggttgtggctgcctttcgcgcagtgattgcccgttgcgtaacccgggcgaccgcttaggagaagaaggtaccggcgcacgcttgctggaagatgaacaaaactaatactagtagcggccgctgcagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagaggaattcgcggccgcttctagagaatcgctttacctcaagttaacttgaggaattatactccccaacagatgaattaacgaactgtactagtagcggccgctgcag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z