BBa_K223052 1 BBa_K223052 5MT Mutant TrpR gene 2009-10-17T11:00:00Z 2015-05-08T01:11:31Z Original part taken from GenBank Escherichia coli IAI1: http://www.ncbi.nlm.nih.gov/nuccore/218552585?from=4690442&to=4690768& report=gbwithparts Two point mutation modifications made to change protein residue at 58 and 79 to Leu and Lys, respectively. The 5 methyl-L-tryptophan aporepressor gene is a mutant version of the regular TrpR gene involved in sensing levels of synthetic compound, 5 MT. It works by binding to its corepressor, 5 MT, and then to its corresponding promoter operator, BBa_K223051, repressing downstream transcription. In the presence of low corepressor levels, the 5MT aporepressor will not bind allowing for downstream transcription. false false _380_ 0 4529 9 Not in stock false n/a false Anusuya Ramasubramanian BBa_K223052_sequence 1 gaattcgcggccgcttctagatggcccaacaatcaccctattcagcagcgatggcagaacagcgtcaccaggagtggttacgttttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattctggaagagctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcaggcaaagcgacgattacgcgtggatctaacagcctgaaagccgcgcccgtcgagctgcgccagtggctggaagaggtgttgctgaaaagcgattgatactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z