BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K223058 1 BBa_K223058 RBS+mutTrpR+TT+mutTrp Operator 2009-10-17T11:00:00Z 2015-05-08T01:11:31Z Synthesized by Stanford iGEM Team 2009 This part is a combination of K223051 and K223052. It is an inverter that is sensitive to concentration decreases in 5-methyl-L-tryptophan and converts this to a PoPs output signal used for downstream transcription. false false _380_ 0 4529 9 Not in stock false n/a false Anusuya Ramasubramanian component2051604 1 BBa_B0010 component2051606 1 BBa_B0012 component2051602 1 BBa_B0034 component2051610 1 BBa_K223051 component2051603 1 BBa_K223052 annotation2051610 1 BBa_K223051 range2051610 1 534 702 annotation2051603 1 BBa_K223052 range2051603 1 21 388 annotation2051606 1 BBa_B0012 range2051606 1 485 525 annotation2051602 1 BBa_B0034 range2051602 1 1 12 annotation2051604 1 BBa_B0010 range2051604 1 397 476 BBa_K223051 1 BBa_K223051 5MT operon (promoter-operator) 2009-10-17T11:00:00Z 2015-05-08T01:11:31Z Originally taken from "Naturally occurring promoter down mutation: Nucleotide sequence of the trp promoter/operator/leader region of Shigella dysenteriae 16" (Miozzari,G and Yanfosky, C. Proc. Natl. Acad. Sct. USA. Vol. 75, No. 11, pp. 5580-5584, November 1978. Genetics). Sequence modifications done by Stanford iGEM 2009. This is a modified trp operon, promoter and operator site, that recognizes and binds to a doubly mutant repressor sequence and its corepressor, 5-methyl-L-tryptophan. In conjunction with the mutant tryptophan repressor, this modified operon functions as an inverter, converting input 5-methyl tryptophan levels and converting decreasing levels of 5MT into a PoPs output signal for downstream transcription. false false _380_ 0 4529 9 Not in stock false Point mutation from A to C on the second aporepressor binding site (i.e. -18) on the sense strand. false Anusuya Ramasubramanian BBa_K223052 1 BBa_K223052 5MT Mutant TrpR gene 2009-10-17T11:00:00Z 2015-05-08T01:11:31Z Original part taken from GenBank Escherichia coli IAI1: http://www.ncbi.nlm.nih.gov/nuccore/218552585?from=4690442&to=4690768& report=gbwithparts Two point mutation modifications made to change protein residue at 58 and 79 to Leu and Lys, respectively. The 5 methyl-L-tryptophan aporepressor gene is a mutant version of the regular TrpR gene involved in sensing levels of synthetic compound, 5 MT. It works by binding to its corepressor, 5 MT, and then to its corresponding promoter operator, BBa_K223051, repressing downstream transcription. In the presence of low corepressor levels, the 5MT aporepressor will not bind allowing for downstream transcription. false false _380_ 0 4529 9 Not in stock false n/a false Anusuya Ramasubramanian BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K223052_sequence 1 gaattcgcggccgcttctagatggcccaacaatcaccctattcagcagcgatggcagaacagcgtcaccaggagtggttacgttttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattctggaagagctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcaggcaaagcgacgattacgcgtggatctaacagcctgaaagccgcgcccgtcgagctgcgccagtggctggaagaggtgttgctgaaaagcgattgatactagtagcggccgctgcag BBa_B0034_sequence 1 aaagaggagaaa BBa_K223051_sequence 1 gaattcgcggccgcttctagagctcaaggcgcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattctgaaatgacctgttgacaattaatcatcgacctagttacctaggacgcaaggtcacgttactagtagcggccgctgcag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K223058_sequence 1 aaagaggagaaatactagaggaattcgcggccgcttctagatggcccaacaatcaccctattcagcagcgatggcagaacagcgtcaccaggagtggttacgttttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattctggaagagctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcaggcaaagcgacgattacgcgtggatctaacagcctgaaagccgcgcccgtcgagctgcgccagtggctggaagaggtgttgctgaaaagcgattgatactagtagcggccgctgcagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagaggaattcgcggccgcttctagagctcaaggcgcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattctgaaatgacctgttgacaattaatcatcgacctagttacctaggacgcaaggtcacgttactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z