BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K223052 1 BBa_K223052 5MT Mutant TrpR gene 2009-10-17T11:00:00Z 2015-05-08T01:11:31Z Original part taken from GenBank Escherichia coli IAI1: http://www.ncbi.nlm.nih.gov/nuccore/218552585?from=4690442&to=4690768& report=gbwithparts Two point mutation modifications made to change protein residue at 58 and 79 to Leu and Lys, respectively. The 5 methyl-L-tryptophan aporepressor gene is a mutant version of the regular TrpR gene involved in sensing levels of synthetic compound, 5 MT. It works by binding to its corepressor, 5 MT, and then to its corresponding promoter operator, BBa_K223051, repressing downstream transcription. In the presence of low corepressor levels, the 5MT aporepressor will not bind allowing for downstream transcription. false false _380_ 0 4529 9 Not in stock false n/a false Anusuya Ramasubramanian BBa_K223051 1 BBa_K223051 5MT operon (promoter-operator) 2009-10-17T11:00:00Z 2015-05-08T01:11:31Z Originally taken from "Naturally occurring promoter down mutation: Nucleotide sequence of the trp promoter/operator/leader region of Shigella dysenteriae 16" (Miozzari,G and Yanfosky, C. Proc. Natl. Acad. Sct. USA. Vol. 75, No. 11, pp. 5580-5584, November 1978. Genetics). Sequence modifications done by Stanford iGEM 2009. This is a modified trp operon, promoter and operator site, that recognizes and binds to a doubly mutant repressor sequence and its corepressor, 5-methyl-L-tryptophan. In conjunction with the mutant tryptophan repressor, this modified operon functions as an inverter, converting input 5-methyl tryptophan levels and converting decreasing levels of 5MT into a PoPs output signal for downstream transcription. false false _380_ 0 4529 9 Not in stock false Point mutation from A to C on the second aporepressor binding site (i.e. -18) on the sense strand. false Anusuya Ramasubramanian BBa_K223059 1 BBa_K223059 mutTrp (5MT) Inverter with GFP Biobrick part 2009-10-17T11:00:00Z 2015-05-08T01:11:31Z Synthesized by Stanford iGEM 2009 A modification to Biobrick part BBa_K223058. It has a GFP biobrick part, BBa_I13504, at the end of the sequence and functions as a reporter. false false _380_ 0 4529 9 It's complicated true n/a false Anusuya Ramasubramanian component2051636 1 BBa_B0034 component2051628 1 BBa_B0010 component2051626 1 BBa_B0034 component2051638 1 BBa_E0040 component2051630 1 BBa_B0012 component2051634 1 BBa_K223051 component2051627 1 BBa_K223052 component2051639 1 BBa_B0010 component2051641 1 BBa_B0012 annotation2051639 1 BBa_B0010 range2051639 1 1457 1536 annotation2051636 1 BBa_B0034 range2051636 1 711 722 annotation2051628 1 BBa_B0010 range2051628 1 397 476 annotation2051627 1 BBa_K223052 range2051627 1 21 388 annotation2051626 1 BBa_B0034 range2051626 1 1 12 annotation2051630 1 BBa_B0012 range2051630 1 485 525 annotation2051641 1 BBa_B0012 range2051641 1 1545 1585 annotation2051638 1 BBa_E0040 range2051638 1 729 1448 annotation2051634 1 BBa_K223051 range2051634 1 534 702 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K223052_sequence 1 gaattcgcggccgcttctagatggcccaacaatcaccctattcagcagcgatggcagaacagcgtcaccaggagtggttacgttttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattctggaagagctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcaggcaaagcgacgattacgcgtggatctaacagcctgaaagccgcgcccgtcgagctgcgccagtggctggaagaggtgttgctgaaaagcgattgatactagtagcggccgctgcag BBa_K223059_sequence 1 aaagaggagaaatactagaggaattcgcggccgcttctagatggcccaacaatcaccctattcagcagcgatggcagaacagcgtcaccaggagtggttacgttttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattctggaagagctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcaggcaaagcgacgattacgcgtggatctaacagcctgaaagccgcgcccgtcgagctgcgccagtggctggaagaggtgttgctgaaaagcgattgatactagtagcggccgctgcagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagaggaattcgcggccgcttctagagctcaaggcgcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattctgaaatgacctgttgacaattaatcatcgacctagttacctaggacgcaaggtcacgttactagtagcggccgctgcagtactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_K223051_sequence 1 gaattcgcggccgcttctagagctcaaggcgcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattctgaaatgacctgttgacaattaatcatcgacctagttacctaggacgcaaggtcacgttactagtagcggccgctgcag BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z