BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K223052 1 BBa_K223052 5MT Mutant TrpR gene 2009-10-17T11:00:00Z 2015-05-08T01:11:31Z Original part taken from GenBank Escherichia coli IAI1: http://www.ncbi.nlm.nih.gov/nuccore/218552585?from=4690442&to=4690768& report=gbwithparts Two point mutation modifications made to change protein residue at 58 and 79 to Leu and Lys, respectively. The 5 methyl-L-tryptophan aporepressor gene is a mutant version of the regular TrpR gene involved in sensing levels of synthetic compound, 5 MT. It works by binding to its corepressor, 5 MT, and then to its corresponding promoter operator, BBa_K223051, repressing downstream transcription. In the presence of low corepressor levels, the 5MT aporepressor will not bind allowing for downstream transcription. false false _380_ 0 4529 9 Not in stock false n/a false Anusuya Ramasubramanian BBa_K223060 1 BBa_K223060 5MT Inverter-GFP Reporter and Lac Promoter 2009-10-17T11:00:00Z 2015-05-08T01:11:31Z Synthesized by Stanford iGEM 2009 Identical to part BBa_K223059 except with a Lac promoter. This part can be used to test the efficiency of the 5MT inverter system. false false _380_ 0 4529 9 Not in stock false n/a false Anusuya Ramasubramanian component2051663 1 BBa_R0010 component2051672 1 BBa_K223052 component2051681 1 BBa_B0034 component2051673 1 BBa_B0010 component2051683 1 BBa_E0040 component2051686 1 BBa_B0012 component2051671 1 BBa_B0034 component2051684 1 BBa_B0010 component2051675 1 BBa_B0012 component2051679 1 BBa_K223051 annotation2051683 1 BBa_E0040 range2051683 1 937 1656 annotation2051681 1 BBa_B0034 range2051681 1 919 930 annotation2051663 1 BBa_R0010 range2051663 1 1 200 annotation2051684 1 BBa_B0010 range2051684 1 1665 1744 annotation2051686 1 BBa_B0012 range2051686 1 1753 1793 annotation2051679 1 BBa_K223051 range2051679 1 742 910 annotation2051675 1 BBa_B0012 range2051675 1 693 733 annotation2051673 1 BBa_B0010 range2051673 1 605 684 annotation2051672 1 BBa_K223052 range2051672 1 229 596 annotation2051671 1 BBa_B0034 range2051671 1 209 220 BBa_K223051 1 BBa_K223051 5MT operon (promoter-operator) 2009-10-17T11:00:00Z 2015-05-08T01:11:31Z Originally taken from "Naturally occurring promoter down mutation: Nucleotide sequence of the trp promoter/operator/leader region of Shigella dysenteriae 16" (Miozzari,G and Yanfosky, C. Proc. Natl. Acad. Sct. USA. Vol. 75, No. 11, pp. 5580-5584, November 1978. Genetics). Sequence modifications done by Stanford iGEM 2009. This is a modified trp operon, promoter and operator site, that recognizes and binds to a doubly mutant repressor sequence and its corepressor, 5-methyl-L-tryptophan. In conjunction with the mutant tryptophan repressor, this modified operon functions as an inverter, converting input 5-methyl tryptophan levels and converting decreasing levels of 5MT into a PoPs output signal for downstream transcription. false false _380_ 0 4529 9 Not in stock false Point mutation from A to C on the second aporepressor binding site (i.e. -18) on the sense strand. false Anusuya Ramasubramanian BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961225 1 -10 range1961225 1 161 166 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K223060_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagaggaattcgcggccgcttctagatggcccaacaatcaccctattcagcagcgatggcagaacagcgtcaccaggagtggttacgttttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattctggaagagctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcaggcaaagcgacgattacgcgtggatctaacagcctgaaagccgcgcccgtcgagctgcgccagtggctggaagaggtgttgctgaaaagcgattgatactagtagcggccgctgcagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagaggaattcgcggccgcttctagagctcaaggcgcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattctgaaatgacctgttgacaattaatcatcgacctagttacctaggacgcaaggtcacgttactagtagcggccgctgcagtactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K223052_sequence 1 gaattcgcggccgcttctagatggcccaacaatcaccctattcagcagcgatggcagaacagcgtcaccaggagtggttacgttttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattctggaagagctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcaggcaaagcgacgattacgcgtggatctaacagcctgaaagccgcgcccgtcgagctgcgccagtggctggaagaggtgttgctgaaaagcgattgatactagtagcggccgctgcag BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_K223051_sequence 1 gaattcgcggccgcttctagagctcaaggcgcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattctgaaatgacctgttgacaattaatcatcgacctagttacctaggacgcaaggtcacgttactagtagcggccgctgcag BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z