BBa_K227006 1 BBa_K227006 puc BA coding region of R. sphaeroides 2009-10-11T11:00:00Z 2015-05-08T01:11:32Z PCR applified from plasmid pRKCBC3 provided by Dr. Neil Hunter. puc BA is the complete LHII transmembrane protein coding region found naturally in Rhodobacter Sphaeroides. LHII complexes form the light-harvesting antennae the funnel energy down to LHI and the reaction center. They are naturally found in the ratio of 3-6.7 LHII per LHI. Data suggests the precence of puc C,D, and E regions also contribute to the formation of a functional protein. false false _326_ 0 4645 9 It's complicated true puc A and puc B together create the antennae complex necessary to harvest varying intensities of light. A common problem in bioreactors is the uneven distribution of light between cells nearest the light source and cells farther away from the light source. One way of combating this problem is modify the antenna size of the organism. By truncating the light-harvesting antenna, cells at the exterior of the bioreactor waste less light through Non-Photochemical Quenching, thus allowing photons to penetrate deeper and reach cells in the interior of the bioreactor. This leads to an increase in photosynthetic efficiency and productivity for the entire culture. false WashU iGEM 2009 annotation2057320 1 RBS range2057320 1 159 163 annotation2057319 1 pucB range2057319 1 1 156 annotation2057321 1 pucA range2057321 1 172 336 BBa_K227006_sequence 1 gtgactgacgatctgaacaaagtctggccgagcggcctgaccgttgccgaagccgaagaagttcataagcaactcatcctcggcacccgcgtcttcggtggcatggcgctcatcgcgcacttcctcgccgccgctgcgaccccgtggctcggctgataggagaagactgacatgaccaacggcaaaatctggctcgtggtgaaaccgaccgtcggcgttccgctgttcctcagcgctgccgtcatcgcctccgtcgttatccacgctgctgtgctgacgaccaccacctggctgcccgcctactaccaaggctcggctgcggtcgcggccgagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z