BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K227011 1 BBa_K227011 RBS34+OmpR(sphaeroides)+Terminator 2009-10-16T11:00:00Z 2015-05-08T01:11:32Z registry sequences, synthesized by Geneart. ribosome binding site 34 from registry, combined with protein coding for OmpR followed by terminator. false false _326_ 0 4645 9 It's complicated false OmpR(sph) is codon-optimized for use in Rhodobacter sphaeroides. false WashU iGEM 2009 component2057691 1 BBa_B0010 component2057688 1 BBa_B0034 component2057693 1 BBa_B0012 component2057690 1 BBa_K227010 annotation2057690 1 BBa_K227010 range2057690 1 19 738 annotation2057691 1 BBa_B0010 range2057691 1 747 826 annotation2057688 1 BBa_B0034 range2057688 1 1 12 annotation2057693 1 BBa_B0012 range2057693 1 835 875 BBa_K227010 1 BBa_K227010 OmpR (sphaeroides) 2009-10-16T11:00:00Z 2015-05-08T01:11:32Z sequence modified from part BBa_(((())))) OmpR promotor from E.coli, with DNA codon usage optimized for use in Rhodobacter sphaeroides. false false _326_ 0 4645 9 Not in stock false codon usage optimized for Rhodobacter sphaeroides using GeneDesigner. false WashU iGEM 2009 annotation2056947 1 ompR(sph) range2056947 1 1 720 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K227011_sequence 1 aaagaggagaaatactagatgcaggagaactataagatcctggtggtggacgacgacatgcgcctgcgcgccctgctggagcgctacctgaccgagcagggcttccaggtgcgctcggtggccaacgccgagcagatggaccgcctgctgacccgcgagtcgttccatctgatggtgctggacctgatgctgccgggcgaggacggcctgtcgatctgccgccgcctgcgctcgcagtcgaacccgatgccgatcatcatggtgaccgccaagggcgaggaggtggaccgcatcgtgggcctggagatcggcgccgacgactacatcccgaagccgttcaacccgcgcgagctgctggcccgcatccgcgccgtgctgcgccgccaggccaacgagctgccgggcgccccgtcgcaggaggaggccgtgatcgccttcggcaagttcaagctgaacctgggcacccgcgagatgttccgcgaggacgagccgatgccgctgacctcgggcgagttcgccgtgctgaaggccctggtgtcgcatccgcgcgagccgctgtcgcgcgacaagctgatgaacctggcccgcggccgcgagtattcggccatggagcgctcgatcgacgtgcagatctcgcgcctgcgccgcatggtggaggaggacccggcccacccgcgctacatccagaccgtgtggggcctgggctacgtgttcgtgccggacggctcgaaggcctgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_K227010_sequence 1 atgcaggagaactataagatcctggtggtggacgacgacatgcgcctgcgcgccctgctggagcgctacctgaccgagcagggcttccaggtgcgctcggtggccaacgccgagcagatggaccgcctgctgacccgcgagtcgttccatctgatggtgctggacctgatgctgccgggcgaggacggcctgtcgatctgccgccgcctgcgctcgcagtcgaacccgatgccgatcatcatggtgaccgccaagggcgaggaggtggaccgcatcgtgggcctggagatcggcgccgacgactacatcccgaagccgttcaacccgcgcgagctgctggcccgcatccgcgccgtgctgcgccgccaggccaacgagctgccgggcgccccgtcgcaggaggaggccgtgatcgccttcggcaagttcaagctgaacctgggcacccgcgagatgttccgcgaggacgagccgatgccgctgacctcgggcgagttcgccgtgctgaaggccctggtgtcgcatccgcgcgagccgctgtcgcgcgacaagctgatgaacctggcccgcggccgcgagtattcggccatggagcgctcgatcgacgtgcagatctcgcgcctgcgccgcatggtggaggaggacccggcccacccgcgctacatccagaccgtgtggggcctgggctacgtgttcgtgccggacggctcgaaggcctga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z