BBa_K228001 1 BBa_K228001 SupD-tRNA 2009-08-24T11:00:00Z 2015-05-08T01:11:32Z SupD-tRNA again is from Voigt Lab(UCSF), We standardlize this part by PCR strategy. Released HQ 2013 The SupD-tRNA part functions as a tRNA, it suppresses the TAG amber stop codon and translate it into a Ser. There is no need to assembly SupD-tRNA with a rbs, since it is not translated. This part, together with the T7ptag part, make an AND Gate, that is, in the presence of both the 2 parts, T7 polymerase is tranlated into a functional polymerase that transcrips a downstream element constructed after a T7 promoter. Which is the output of the AND Gate. false false _353_ 0 4253 9 In stock true There is a PstI site in the original sequence, but luckily it is near the 3' end of this part, so we designed a mutation in our primer and mutated the PstI site. false Lin Min BBa_K228001_sequence 1 caattcggagagatgccggagcggctgaacggaccggtctctaaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactacagatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z