BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K228001 1 BBa_K228001 SupD-tRNA 2009-08-24T11:00:00Z 2015-05-08T01:11:32Z SupD-tRNA again is from Voigt Lab(UCSF), We standardlize this part by PCR strategy. Released HQ 2013 The SupD-tRNA part functions as a tRNA, it suppresses the TAG amber stop codon and translate it into a Ser. There is no need to assembly SupD-tRNA with a rbs, since it is not translated. This part, together with the T7ptag part, make an AND Gate, that is, in the presence of both the 2 parts, T7 polymerase is tranlated into a functional polymerase that transcrips a downstream element constructed after a T7 promoter. Which is the output of the AND Gate. false false _353_ 0 4253 9 In stock true There is a PstI site in the original sequence, but luckily it is near the 3' end of this part, so we designed a mutation in our primer and mutated the PstI site. false Lin Min BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K228100 1 BBa_K228100 SupD + terminator 2009-09-07T11:00:00Z 2015-05-08T01:11:32Z It is made up of the basic subparts from the partsregistry. SupD is a tRNA coding gene, and it can be well terminated by the terminator BBa_B0015. You can fuse them after a certain promoter. false false _353_ 0 4403 9 It's complicated false false Shan Shen component2019663 1 BBa_K228001 component2019666 1 BBa_B0012 component2019664 1 BBa_B0010 annotation2019663 1 BBa_K228001 range2019663 1 1 136 annotation2019664 1 BBa_B0010 range2019664 1 145 224 annotation2019666 1 BBa_B0012 range2019666 1 233 273 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K228100_sequence 1 caattcggagagatgccggagcggctgaacggaccggtctctaaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactacagatccttagcgaaagctaaggattttttttaagcttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K228001_sequence 1 caattcggagagatgccggagcggctgaacggaccggtctctaaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactacagatccttagcgaaagctaaggattttttttaagct BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z