BBa_K228863 1 BBa_K228863 PhiR73 delta with amber mutation 2009-09-21T11:00:00Z 2015-05-08T01:11:34Z part registery 2009 distribution & PKU 2009 igem team T7 polymerase with an amber mutation coding gene is constructed after AraC protein(reversed sequence) and Pbad promoter which would be triggered by Arabinose. T7 polymerase can work well in the exsitence of SupD tRNA. Besides, the expression of the T7 polymerase can be regulated by RBS. false false _353_ 0 4411 9 Not in stock false when cut this part for insert and ligate it into a vetor, the insert and vector may have the similar sizes which may disturb the ligation. false Lin Min annotation2044025 1 cds range2044025 1 1 243 annotation2044056 1 TAG amber mutation range2044056 1 25 27 BBa_K228863_sequence 1 atgcgctgccctttctgtcgtcattaggcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z