BBa_K228863 1 BBa_K228863 PhiR73 delta with amber mutation 2009-09-21T11:00:00Z 2015-05-08T01:11:34Z part registery 2009 distribution & PKU 2009 igem team T7 polymerase with an amber mutation coding gene is constructed after AraC protein(reversed sequence) and Pbad promoter which would be triggered by Arabinose. T7 polymerase can work well in the exsitence of SupD tRNA. Besides, the expression of the T7 polymerase can be regulated by RBS. false false _353_ 0 4411 9 Not in stock false when cut this part for insert and ligate it into a vetor, the insert and vector may have the similar sizes which may disturb the ligation. false Lin Min annotation2044025 1 cds range2044025 1 1 243 annotation2044056 1 TAG amber mutation range2044056 1 25 27 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K228864 1 BBa_K228864 RBS(B0034)-mutated PhiR73 delta(K228863) 2009-09-21T11:00:00Z 2015-05-08T01:11:34Z part registery 2009 distribution & PKU 2009 igem team T7 polymerase with an amber mutation coding gene is constructed after AraC protein(reversed sequence) and Pbad promoter which would be triggered by Arabinose. T7 polymerase can work well in the exsitence of SupD tRNA. Besides, the expression of the T7 polymerase can be regulated by RBS. false false _353_ 0 4411 9 It's complicated false when cut this part for insert and ligate it into a vetor, the insert and vector may have the similar sizes which may disturb the ligation. false Lin Min component2044116 1 BBa_B0034 component2044119 1 BBa_K228863 annotation2044119 1 BBa_K228863 range2044119 1 19 261 annotation2044116 1 BBa_B0034 range2044116 1 1 12 BBa_K228864_sequence 1 aaagaggagaaatactagatgcgctgccctttctgtcgtcattaggcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K228863_sequence 1 atgcgctgccctttctgtcgtcattaggcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z