BBa_K228851 1 BBa_K228851 Sal+supD+terminator 2009-09-20T11:00:00Z 2015-05-08T01:11:34Z This is a salicylate inducible part and can produce supD, which is a tRNA coding gene and it can be well terminated by the terminator BBa_B0015. false false _353_ 0 5502 9 It's complicated false false He Siheng component2023162 1 BBa_B0012 component2023159 1 BBa_K228001 component2023158 1 BBa_K228004 component2023160 1 BBa_B0010 annotation2023159 1 BBa_K228001 range2023159 1 1061 1196 annotation2023160 1 BBa_B0010 range2023160 1 1205 1284 annotation2023162 1 BBa_B0012 range2023162 1 1293 1333 annotation2023158 1 BBa_K228004 range2023158 1 1 1052 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K228864 1 BBa_K228864 RBS(B0034)-mutated PhiR73 delta(K228863) 2009-09-21T11:00:00Z 2015-05-08T01:11:34Z part registery 2009 distribution & PKU 2009 igem team T7 polymerase with an amber mutation coding gene is constructed after AraC protein(reversed sequence) and Pbad promoter which would be triggered by Arabinose. T7 polymerase can work well in the exsitence of SupD tRNA. Besides, the expression of the T7 polymerase can be regulated by RBS. false false _353_ 0 4411 9 It's complicated false when cut this part for insert and ligate it into a vetor, the insert and vector may have the similar sizes which may disturb the ligation. false Lin Min component2044119 1 BBa_K228863 component2044116 1 BBa_B0034 annotation2044116 1 BBa_B0034 range2044116 1 1 12 annotation2044119 1 BBa_K228863 range2044119 1 19 261 BBa_K228873 1 BBa_K228873 AND GATE AraC+RBS(J61100)+T7ptag+Sal+SupD 2009-09-21T11:00:00Z 2015-05-08T01:11:35Z It is made up of standard subparts from the partregistry. {{PKU_Beijing2009_AND_GATE_FAMILY}} This is an AND GATE in Ecoli. Use salicylate to induce the transcription of SupD and use arabinose to induce the transcription of T7ptag. If the SupD tRNA exists, T7ptag can be translated into functional T7 polymerase, and otherwise the translation of T7ptag will come to stop because of some amber stop codon mutations in the T7ptag. The T7 polymerase will activate a T7 promoter. This gate is only one of nine gates(K228870-K228878), which are distinguished by the RBS of T7ptag. For more information: refer to K228000(T7ptag) and K228001(SupD) referrence: Anderson JC, Voigt CA, Arkin AP (2007) Environmental signal integration by a modular AND gate. Mol Syst Biol 3: 133 false false _353_ 0 4411 9 It's complicated false false Haoqian Zhang component2230492 1 BBa_K228851 component2230498 1 BBa_K228864 annotation2230498 1 BBa_K228864 range2230498 1 1342 1602 annotation2230492 1 BBa_K228851 range2230492 1 1 1333 BBa_K228004 1 BBa_K228004 NahR( reverse) - salicylate promoter 2009-09-17T11:00:00Z 2015-05-08T01:11:32Z It is constrcuted by PCR from the plasmid kindly provided by Voigt Lab in UCSF. This is a salicylate inducible promoter part. The activator protein is right upstream but in a opposite direction of the regulated promoter. In the presence of salicylate, the promoter can be activated. false false _353_ 0 4253 9 It's complicated true There is no termoinator downstream of the NahR coding sequence, but it has no effect on parts that are in the same direction as the pSal promoter. However, if coding gene is placed upstream of this part and in the same direction as NahR, it may cause unwanted expression. false Lin Min annotation2075287 1 pSal range2075287 1 982 1050 annotation2075285 1 NahR range2075285 1 1 903 annotation2075286 1 Pr promoter range2075286 1 904 993 BBa_K228863 1 BBa_K228863 PhiR73 delta with amber mutation 2009-09-21T11:00:00Z 2015-05-08T01:11:34Z part registery 2009 distribution & PKU 2009 igem team T7 polymerase with an amber mutation coding gene is constructed after AraC protein(reversed sequence) and Pbad promoter which would be triggered by Arabinose. T7 polymerase can work well in the exsitence of SupD tRNA. Besides, the expression of the T7 polymerase can be regulated by RBS. false false _353_ 0 4411 9 Not in stock false when cut this part for insert and ligate it into a vetor, the insert and vector may have the similar sizes which may disturb the ligation. false Lin Min annotation2044025 1 cds range2044025 1 1 243 annotation2044056 1 TAG amber mutation range2044056 1 25 27 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K228001 1 BBa_K228001 SupD-tRNA 2009-08-24T11:00:00Z 2015-05-08T01:11:32Z SupD-tRNA again is from Voigt Lab(UCSF), We standardlize this part by PCR strategy. Released HQ 2013 The SupD-tRNA part functions as a tRNA, it suppresses the TAG amber stop codon and translate it into a Ser. There is no need to assembly SupD-tRNA with a rbs, since it is not translated. This part, together with the T7ptag part, make an AND Gate, that is, in the presence of both the 2 parts, T7 polymerase is tranlated into a functional polymerase that transcrips a downstream element constructed after a T7 promoter. Which is the output of the AND Gate. false false _353_ 0 4253 9 In stock true There is a PstI site in the original sequence, but luckily it is near the 3' end of this part, so we designed a mutation in our primer and mutated the PstI site. false Lin Min BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K228864_sequence 1 aaagaggagaaatactagatgcgctgccctttctgtcgtcattaggcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K228863_sequence 1 atgcgctgccctttctgtcgtcattaggcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa BBa_K228851_sequence 1 tcaatccgtaaacaggtcaaacatcagttgccgcaaccaaatattggctaggtccttgtggtacttcgcatgccagaacatgttgatggctatttcaggcaagacgactgggtgcggcaaggcgcttaggccgaagggctccacgcagcagtcggctaaacgtatcggcacagtggcgagcagatcggtgcgctggaggatgtggccaacggcggcgaagtgcggcacttccagacggatgtcgcgccggatgccgacccgtgtcatgtacgtgtccacctcgccgtggccggtgccagcggcgatgacacgcacgtggccgtaggaacagaagcgctccagagtcaggggttcgcgggtgactggatggtccttgcgacataggcacacgtagtgattctggagcagccggcgctgaaagaagccagtttgcagattgggaagcaggcccacggccaagtccacggttccgttctgcaaggcctgcatcaggctcatcgaactgtcgcgcaccgtactgatcacgcaattgggggcctggtgagccagcacatccatcagccgcggcatgaagtagatctcgccaatgtcggtcatggccagggtgaaggtacgctcgctggtcagcggatcgaagctttcatggtgctgtagggcgttgcgcagtgcgtgcatggccgaagtgacgggctcggccagatgcgcggcatagggtgtgggttccattccctgatgtgtgcgcacgaagagtgggtcctgtagcgaggtgcgcaggcgtttcagcgcattgctcacggcaggctgggtcaggcccaggttctccgcagtgatagagacgcgtctgtcgaccagcaactggttgaacaccaccagcaggtttaaatccaggtcacgcagttccatggggcctcgcttgggttattgctggtgcccggccgggcgcaatattcatgttgatgatttattatatatcgagtggtgtatttatcaatattgtttgctccgttatcgttattaacaagtcatcaataaagccatcacgagtaccatagtactagagcaattcggagagatgccggagcggctgaacggaccggtctctaaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactacagatccttagcgaaagctaaggattttttttaagcttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K228004_sequence 1 tcaatccgtaaacaggtcaaacatcagttgccgcaaccaaatattggctaggtccttgtggtacttcgcatgccagaacatgttgatggctatttcaggcaagacgactgggtgcggcaaggcgcttaggccgaagggctccacgcagcagtcggctaaacgtatcggcacagtggcgagcagatcggtgcgctggaggatgtggccaacggcggcgaagtgcggcacttccagacggatgtcgcgccggatgccgacccgtgtcatgtacgtgtccacctcgccgtggccggtgccagcggcgatgacacgcacgtggccgtaggaacagaagcgctccagagtcaggggttcgcgggtgactggatggtccttgcgacataggcacacgtagtgattctggagcagccggcgctgaaagaagccagtttgcagattgggaagcaggcccacggccaagtccacggttccgttctgcaaggcctgcatcaggctcatcgaactgtcgcgcaccgtactgatcacgcaattgggggcctggtgagccagcacatccatcagccgcggcatgaagtagatctcgccaatgtcggtcatggccagggtgaaggtacgctcgctggtcagcggatcgaagctttcatggtgctgtagggcgttgcgcagtgcgtgcatggccgaagtgacgggctcggccagatgcgcggcatagggtgtgggttccattccctgatgtgtgcgcacgaagagtgggtcctgtagcgaggtgcgcaggcgtttcagcgcattgctcacggcaggctgggtcaggcccaggttctccgcagtgatagagacgcgtctgtcgaccagcaactggttgaacaccaccagcaggtttaaatccaggtcacgcagttccatggggcctcgcttgggttattgctggtgcccggccgggcgcaatattcatgttgatgatttattatatatcgagtggtgtatttatcaatattgtttgctccgttatcgttattaacaagtcatcaataaagccatcacgagtaccatag BBa_K228001_sequence 1 caattcggagagatgccggagcggctgaacggaccggtctctaaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactacagatccttagcgaaagctaaggattttttttaagct BBa_K228873_sequence 1 tcaatccgtaaacaggtcaaacatcagttgccgcaaccaaatattggctaggtccttgtggtacttcgcatgccagaacatgttgatggctatttcaggcaagacgactgggtgcggcaaggcgcttaggccgaagggctccacgcagcagtcggctaaacgtatcggcacagtggcgagcagatcggtgcgctggaggatgtggccaacggcggcgaagtgcggcacttccagacggatgtcgcgccggatgccgacccgtgtcatgtacgtgtccacctcgccgtggccggtgccagcggcgatgacacgcacgtggccgtaggaacagaagcgctccagagtcaggggttcgcgggtgactggatggtccttgcgacataggcacacgtagtgattctggagcagccggcgctgaaagaagccagtttgcagattgggaagcaggcccacggccaagtccacggttccgttctgcaaggcctgcatcaggctcatcgaactgtcgcgcaccgtactgatcacgcaattgggggcctggtgagccagcacatccatcagccgcggcatgaagtagatctcgccaatgtcggtcatggccagggtgaaggtacgctcgctggtcagcggatcgaagctttcatggtgctgtagggcgttgcgcagtgcgtgcatggccgaagtgacgggctcggccagatgcgcggcatagggtgtgggttccattccctgatgtgtgcgcacgaagagtgggtcctgtagcgaggtgcgcaggcgtttcagcgcattgctcacggcaggctgggtcaggcccaggttctccgcagtgatagagacgcgtctgtcgaccagcaactggttgaacaccaccagcaggtttaaatccaggtcacgcagttccatggggcctcgcttgggttattgctggtgcccggccgggcgcaatattcatgttgatgatttattatatatcgagtggtgtatttatcaatattgtttgctccgttatcgttattaacaagtcatcaataaagccatcacgagtaccatagtactagagcaattcggagagatgccggagcggctgaacggaccggtctctaaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactacagatccttagcgaaagctaaggattttttttaagcttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaaagaggagaaatactagatgcgctgccctttctgtcgtcattaggcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z