BBa_K233004 1 BBa_K233004 lac operator 2009-07-09T11:00:00Z 2015-05-08T01:11:35Z E.coli This contains the lacI binding sites without any of the -10 and -35 regions of the promoter.therefore it is only repressed by the binding of LacI false false _329_ 0 4258 9 It's complicated true had it synthesized false Swetha Srinivasan, Samit Watve, Mandar Phatak, Chinar Patil BBa_I746365 1 BBa_I746365 PLL promoter from P4 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z P4 phage genome sequence This is the PLL promoter taken from the P4 phage genome. It is an inducible promoter that is activated by a class of activators, including P2 ogr (I746350), PSP3 pag (I746351) and phiR73 delta (I746352). These different activators should cause different levels of activity of the PLL promoter. false false _116_ 0 2122 9 In stock false no special considerations true Stefan Milde annotation1943788 1 PLL range1943788 1 1 92 BBa_K233005 1 BBa_K233005 AND gate 2 2009-07-09T11:00:00Z 2015-05-08T01:11:35Z E.coli- lac operator pLL- phage p4 this module can be used as an AND gate with 2 chemically regulated inputs and a protein output. false false _329_ 0 4258 9 Not in stock false synthesized lacO and added it to the pLL biobrick false swetha srinivasan, samit watve, mandar phatak, chinar patil component2372969 1 BBa_K233004 component2372968 1 BBa_I746365 annotation2372969 1 BBa_K233004 range2372969 1 101 130 annotation2372968 1 BBa_I746365 range2372968 1 1 92 BBa_K233004_sequence 1 tgtggaattgtgagcgctcacaattccaca BBa_K233005_sequence 1 gtggagatgaacaaaaaacacacagccattgtaagacagcctgaacaaatcccccctgttgcgtctgctgaaaatattcacaaaataaagcgtactagagtgtggaattgtgagcgctcacaattccaca BBa_I746365_sequence 1 gtggagatgaacaaaaaacacacagccattgtaagacagcctgaacaaatcccccctgttgcgtctgctgaaaatattcacaaaataaagcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z