BBa_K233309 1 BBa_K233309 YcdB-GFP 2009-10-15T11:00:00Z 2015-05-08T01:11:35Z a a false false _329_ 0 4258 9 It's complicated false a false swetha srinivasan, chinar patil, mandar phatak, samit watve component2046716 1 BBa_E0040 component2046714 1 BBa_K233306 annotation2046716 1 BBa_E0040 range2046716 1 130 849 annotation2046714 1 BBa_K233306 range2046714 1 1 123 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K233306 1 BBa_K233306 YcdB - This part is a export tag that utilizes the Twin Arginine Transport pathway(TAT) 2009-10-15T11:00:00Z 2015-05-08T01:11:35Z E.coli The Tat (twin-arginine translocation) system of Escherichia coli serves to translocate folded proteins across the cytoplasmic membrane. The reasons established so far for the Tat dependence are cytoplasmic cofactor assembly and/or heterodimerization of the respective proteins. We were interested in the reasons for the Tat dependence of novel Tat substrates and focused on two uncharacterized proteins, YcdO and YcdB. Both proteins contain predicted Tat signal sequences. However, we found that only YcdB was indeed Tat-dependently translocated, whereas YcdO was equally well translocated in a Tat-deficient strain. YcdB is a dimeric protein and contains a heme cofactor that was identified to be a high-spin Fe(III)-protoporphyrin IX complex. In contrast to all other periplasmic hemoproteins analyzed so far, heme was assembled into YcdB in the cytoplasm, suggesting that heme assembly could take place prior to translocation. The function of YcdB in the periplasm may be related to a detoxification reaction under specific conditions because YcdB had peroxidase activity at acidic pH, which coincides well with the known acid-induced expression of the gene false false _329_ 0 4258 9 It's complicated true We had to add a base at the end of the tag in such a way that when it was fused with the gene of the protein to be secreted, it would be an in-frame after the scar that would result due to standard assembly. we therefore chose to add a 'C' to the end of the designed export tag to allow it to be fused in frame. this caused an addition of alanine when translated. we checked the changes in secondary structure that this addition caused by the available online tools like SOPMA and SSpro. no significant changes were predicted false Swetha Srinivasan, Samit Watve, Mandar Phatak, Chinar Patil BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K233306_sequence 1 atgcagtacaaagacgaaaacggtgttaatgagccgtctcgtcgccgtctgctgaaggttatcggcgcgctggctctggcaggttcctgcccggtggcgcatgcgcagaaaactcaatctgcc BBa_K233309_sequence 1 atgcagtacaaagacgaaaacggtgttaatgagccgtctcgtcgccgtctgctgaaggttatcggcgcgctggctctggcaggttcctgcccggtggcgcatgcgcagaaaactcaatctgcctactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z