BBa_K233312 1 BBa_K233312 GFP secretion device using Ycdb 2009-10-15T11:00:00Z 2015-05-08T01:11:35Z a a false false _329_ 0 4258 9 It's complicated false a false swetha srinivasan,samit watve, mandar phatak, chinar patil component2046954 1 BBa_E0040 component2046945 1 BBa_R0040 component2046952 1 BBa_K233306 component2046951 1 BBa_B0034 annotation2046945 1 BBa_R0040 range2046945 1 1 54 annotation2046954 1 BBa_E0040 range2046954 1 210 929 annotation2046952 1 BBa_K233306 range2046952 1 81 203 annotation2046951 1 BBa_B0034 range2046951 1 63 74 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K233306 1 BBa_K233306 YcdB - This part is a export tag that utilizes the Twin Arginine Transport pathway(TAT) 2009-10-15T11:00:00Z 2015-05-08T01:11:35Z E.coli The Tat (twin-arginine translocation) system of Escherichia coli serves to translocate folded proteins across the cytoplasmic membrane. The reasons established so far for the Tat dependence are cytoplasmic cofactor assembly and/or heterodimerization of the respective proteins. We were interested in the reasons for the Tat dependence of novel Tat substrates and focused on two uncharacterized proteins, YcdO and YcdB. Both proteins contain predicted Tat signal sequences. However, we found that only YcdB was indeed Tat-dependently translocated, whereas YcdO was equally well translocated in a Tat-deficient strain. YcdB is a dimeric protein and contains a heme cofactor that was identified to be a high-spin Fe(III)-protoporphyrin IX complex. In contrast to all other periplasmic hemoproteins analyzed so far, heme was assembled into YcdB in the cytoplasm, suggesting that heme assembly could take place prior to translocation. The function of YcdB in the periplasm may be related to a detoxification reaction under specific conditions because YcdB had peroxidase activity at acidic pH, which coincides well with the known acid-induced expression of the gene false false _329_ 0 4258 9 It's complicated true We had to add a base at the end of the tag in such a way that when it was fused with the gene of the protein to be secreted, it would be an in-frame after the scar that would result due to standard assembly. we therefore chose to add a 'C' to the end of the designed export tag to allow it to be fused in frame. this caused an addition of alanine when translated. we checked the changes in secondary structure that this addition caused by the available online tools like SOPMA and SSpro. no significant changes were predicted false Swetha Srinivasan, Samit Watve, Mandar Phatak, Chinar Patil BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_K233312_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgcagtacaaagacgaaaacggtgttaatgagccgtctcgtcgccgtctgctgaaggttatcggcgcgctggctctggcaggttcctgcccggtggcgcatgcgcagaaaactcaatctgcctactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K233306_sequence 1 atgcagtacaaagacgaaaacggtgttaatgagccgtctcgtcgccgtctgctgaaggttatcggcgcgctggctctggcaggttcctgcccggtggcgcatgcgcagaaaactcaatctgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z