BBa_J23102 1 BBa_J23102 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters Released HQ 2013 replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K235009 1 BBa_K235009 [J23102][J23032] (constitutive promoter+ribolocked RBS) 2009-09-02T11:00:00Z 2015-05-08T01:11:35Z J23102+J23032 Just an intermediate part. false false _336_ 0 5167 9 Not in stock false Constructed using three-antibiotic assembly. On plasmid pSB1C3. false Kyliah Clarkson component2018371 1 BBa_J23102 component2018372 1 BBa_J23032 annotation2018371 1 BBa_J23102 range2018371 1 1 35 annotation2018372 1 BBa_J23032 range2018372 1 44 86 BBa_J23032 1 BBa_J23032 [lock3d] 2006-08-02T11:00:00Z 2015-08-31T04:08:39Z Extension of overlapping oligonucleotides lock3d false false _52_ 0 483 95 In stock false N/A true John Anderson BBa_K235009_sequence 1 ttgacagctagctcagtcctaggtactgtgctagctactagagaactagaatcacctcttgcttttgggtaagacagaagaggaga BBa_J23032_sequence 1 aactagaatcacctcttgcttttgggtaagacagaagaggaga BBa_J23102_sequence 1 ttgacagctagctcagtcctaggtactgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z