BBa_J23102 1 BBa_J23102 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters Released HQ 2013 replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K235030 1 BBa_K235030 [J23102][K115017] (constituitive promoter+32??C RBS thermometer) 2009-10-15T11:00:00Z 2015-05-08T01:11:36Z J23102+K115017 This is a constituitive promoter+RBS complex that is designed to initiate translation around 32??C. Used in parts BBa_K235033, BBa_K235036 and BBa_K235037. false false _336_ 0 5572 9 Not in stock false Constructed using 3A assembly. false Natasha Tuskovich component2046578 1 BBa_J23102 component2046580 1 BBa_K115017 annotation2046580 1 BBa_K115017 range2046580 1 44 126 annotation2046578 1 BBa_J23102 range2046578 1 1 35 BBa_K115017 1 BBa_K115017 RNA thermometer (ROSE 32??C) 2008-08-19T11:00:00Z 2015-05-08T01:09:28Z Based on ROSE RNA thermometer sequences from Rfam database. Released HQ 2013 An RNA thermometer that theoretically switches on translation at 32 degrees Celcius and switched of translation below that temperature. Still to be tested. false false _223_ 0 3006 9 In stock true a lot, will be added soon. true Bastiaan van den Berg annotation1972920 1 SD range1972920 1 77 82 BBa_K115017_sequence 1 ccgggcgcccttcgggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtccagtctttgctcagtggaggat BBa_K235030_sequence 1 ttgacagctagctcagtcctaggtactgtgctagctactagagccgggcgcccttcgggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtccagtctttgctcagtggaggat BBa_J23102_sequence 1 ttgacagctagctcagtcctaggtactgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z